ID: 1002099733

View in Genome Browser
Species Human (GRCh38)
Location 5:176851474-176851496
Sequence ATGCCGCCATATGTGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002099726_1002099733 20 Left 1002099726 5:176851431-176851453 CCCCAGCTCTGGCGGGGCACACA 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1002099729_1002099733 -8 Left 1002099729 5:176851459-176851481 CCAGTGAGATATGAAATGCCGCC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1002099722_1002099733 26 Left 1002099722 5:176851425-176851447 CCCCGGCCCCAGCTCTGGCGGGG 0: 1
1: 0
2: 1
3: 34
4: 352
Right 1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1002099724_1002099733 25 Left 1002099724 5:176851426-176851448 CCCGGCCCCAGCTCTGGCGGGGC 0: 1
1: 0
2: 1
3: 50
4: 416
Right 1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1002099728_1002099733 18 Left 1002099728 5:176851433-176851455 CCAGCTCTGGCGGGGCACACATT 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1002099725_1002099733 24 Left 1002099725 5:176851427-176851449 CCGGCCCCAGCTCTGGCGGGGCA 0: 1
1: 0
2: 7
3: 32
4: 363
Right 1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1002099719_1002099733 29 Left 1002099719 5:176851422-176851444 CCACCCCGGCCCCAGCTCTGGCG 0: 1
1: 0
2: 1
3: 71
4: 636
Right 1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1002099727_1002099733 19 Left 1002099727 5:176851432-176851454 CCCAGCTCTGGCGGGGCACACAT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002099733 Original CRISPR ATGCCGCCATATGTGGGACA GGG Intronic
900031068 1:373604-373626 ACACAGCCACATGTGGGACAGGG + Intergenic
900051639 1:601858-601880 ACACAGCCACATGTGGGACAGGG + Intergenic
906479267 1:46189546-46189568 GTGCCTCCATATCTGGGACCTGG - Exonic
909651480 1:77980434-77980456 ATGCCACGATATGTTGGAGAAGG - Intronic
911931505 1:103909753-103909775 AGGCAGCCATCTGTGAGACAAGG - Intergenic
918646623 1:186913860-186913882 CTGCAACCACATGTGGGACAGGG - Intronic
1064625739 10:17259576-17259598 ATGCCCCCATAGGTTAGACATGG + Intergenic
1067748995 10:48957654-48957676 ATGAACCCATTTGTGGGACATGG - Intronic
1072247265 10:93554779-93554801 TTGCCCCCATATGTGGGCCCAGG + Intergenic
1074280801 10:112049741-112049763 CTTCTGCCATATGTGAGACAGGG + Intergenic
1074693207 10:116025615-116025637 ATGCAGCCATATGCGGGCCTAGG + Intergenic
1076620077 10:131781357-131781379 ATGCAGGCATCTGGGGGACAGGG + Intergenic
1077366100 11:2161994-2162016 ATGCCGCCATGGATGGGCCAAGG + Intergenic
1081507296 11:43731855-43731877 ATGCTGCCATTTTTTGGACACGG - Intronic
1083228822 11:61302197-61302219 ATCCCGGCATATGTGGCACACGG - Intronic
1090733498 11:129591549-129591571 AGGCCTGCATCTGTGGGACAGGG - Intergenic
1091818328 12:3455878-3455900 GTGACACCATAGGTGGGACAGGG + Intronic
1102148176 12:110670232-110670254 AAGCCGCCATCTGTGGGAGGGGG + Intronic
1104259248 12:127167374-127167396 ATGCAGCCCAATGTGGGATAGGG + Intergenic
1109887967 13:68567120-68567142 ATGCCCACATATATGGAACAAGG + Intergenic
1115263364 14:31475553-31475575 ATGCCGCCATTTTTGGAACATGG + Intergenic
1121201197 14:92119993-92120015 ATGCCCCCATATGTGAAACTTGG - Intronic
1122757003 14:103989660-103989682 ATGGTGCCATATTTGGGACTTGG + Intronic
1128094542 15:64943915-64943937 CAACCCCCATATGTGGGACAGGG + Intronic
1128522928 15:68387280-68387302 ATGCCTCCATCTGTGGGGCCAGG - Intronic
1130730114 15:86483143-86483165 ATGCCGCCATATTTTGAACATGG - Intronic
1134448162 16:14346301-14346323 ATGTCACCATATGTAGCACAAGG + Intergenic
1134672355 16:16065147-16065169 ATGACGCCAAATGAGGTACAGGG + Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1140059825 16:71558917-71558939 GTGAGGCCATATGTGGGAGATGG - Intronic
1141592981 16:85080997-85081019 AAGCCACCATCTGTAGGACACGG - Intronic
1147325820 17:39668961-39668983 ATGGAGGCAGATGTGGGACAGGG + Intronic
1151431103 17:74063794-74063816 ATGCCTCCATATGGTGGAGACGG - Intergenic
1152939931 17:83163258-83163280 ATGTCACCATATTTGGGAAAAGG + Intergenic
1152948572 17:83212065-83212087 ACACAGCCACATGTGGGACAGGG - Intergenic
1155785052 18:29885669-29885691 ATGCCACCATATGGAGGAAAAGG - Intergenic
1162521079 19:11179852-11179874 AAGCAGCCATATGTGGCCCAGGG - Intronic
1168090111 19:54077011-54077033 ATGCAGCCATGTGTGAAACAGGG - Intronic
927118176 2:19925336-19925358 ATTCTGCCATATGTGGGAATGGG + Intronic
940860223 2:158763524-158763546 ATGCAGCCACATGTGGAAAATGG + Intergenic
948846828 2:240687373-240687395 AGGCCCCCATATGTGAGTCAGGG - Intergenic
1176105598 20:63384344-63384366 AGGCGGCCATGTGCGGGACAAGG + Intergenic
949888583 3:8715125-8715147 AAGCTGCCATGTGTGGGACTAGG - Intronic
961782498 3:129328853-129328875 GTGCTGCCACCTGTGGGACAGGG - Intergenic
966962312 3:184952685-184952707 ATGCTGCCATATTTTGAACACGG - Intronic
967473457 3:189889456-189889478 ATGCTGCAATCTGTGGGATACGG - Exonic
968739256 4:2319125-2319147 AGACCCCCATATGTGGGGCAGGG + Intronic
968903451 4:3441507-3441529 GTGCTGCCGTCTGTGGGACAGGG + Intergenic
969545679 4:7826112-7826134 AACCCACCATATTTGGGACAGGG + Intronic
970745099 4:19284633-19284655 ATGCTGCCTTATTTGGGAAAGGG + Intergenic
975457467 4:74609082-74609104 ATGGTTCAATATGTGGGACAGGG + Intergenic
984192224 4:176619715-176619737 ATGCCACCATTTTTTGGACATGG - Intergenic
984704157 4:182835537-182835559 ATGCAGACATTTGTGGGAGAGGG - Intergenic
987450203 5:18074069-18074091 ATGCAGACATAAGTGGGAGACGG - Intergenic
987557856 5:19478615-19478637 AGGCCACCATAAGTGAGACATGG - Intronic
992105056 5:73443687-73443709 ATGACACCATGTGTGGTACAAGG + Intergenic
995738188 5:115325855-115325877 ATGCCTCCAGCTGTGGGTCATGG - Intergenic
997887981 5:137648488-137648510 TTGCTGCCATCTGTGGAACAGGG + Intronic
999690621 5:154143009-154143031 ATGTCACCATATGTGGCAAAAGG - Intronic
1000723278 5:164735168-164735190 ATGCCTCTATGTGTGGGAAAGGG - Intergenic
1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG + Intronic
1002742752 5:181445264-181445286 ACACAGCCACATGTGGGACAGGG - Intergenic
1002946138 6:1763168-1763190 ATGCTGGCAGATGTGGGCCACGG + Intronic
1003789094 6:9522344-9522366 ATGCAGCCACATCTGGGACAAGG + Intergenic
1004147168 6:13078424-13078446 ATGCAGCCTTATTTGGAACAGGG - Intronic
1007937365 6:45744851-45744873 ATGCCGTCAGATGTAGGACCAGG - Intergenic
1019247885 6:170721003-170721025 ACACAGCCACATGTGGGACAGGG - Intergenic
1022147133 7:27555630-27555652 ATGCTGCCATAAGTGGGTAATGG - Intronic
1026070711 7:67116962-67116984 ATGCTTCCATAAGTGGGACTGGG - Intronic
1034392436 7:150797238-150797260 ATGCTGCTATTTGTGGGAAAAGG - Intronic
1035500230 8:86861-86883 ACACAGCCACATGTGGGACAGGG + Intergenic
1042593247 8:70418581-70418603 ATGGTGCCATATGGGGGACTCGG - Intergenic
1049095576 8:140546313-140546335 ATGCTGCCACATGGGGGACCAGG - Intronic
1049300247 8:141865992-141866014 ATGCCTACATATGTGGGGAAGGG + Intergenic
1053303542 9:36968605-36968627 ATACCCCCACATGTGGGCCAAGG + Intronic
1056820441 9:89837974-89837996 GTGCCACAAGATGTGGGACAGGG + Intergenic
1203608655 Un_KI270748v1:76482-76504 ACACAGCCACATGTGGGACAGGG - Intergenic
1187521770 X:20020560-20020582 ATGCAGCCTTATGTAGCACAGGG - Intronic
1188448933 X:30288542-30288564 ATGCCACCATATTTTTGACATGG + Intergenic
1195830103 X:109047541-109047563 ATACGTCCATATGTGGAACAAGG - Intergenic
1197695773 X:129548060-129548082 CTGCCCCCATGTGTGGGGCAGGG + Intronic