ID: 1002101467

View in Genome Browser
Species Human (GRCh38)
Location 5:176860127-176860149
Sequence CCCCGCCAAGAGGCAGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 205}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002101449_1002101467 17 Left 1002101449 5:176860087-176860109 CCCCCACACGCCCAGCCAGGGAC 0: 1
1: 0
2: 1
3: 35
4: 355
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101450_1002101467 16 Left 1002101450 5:176860088-176860110 CCCCACACGCCCAGCCAGGGACC 0: 1
1: 0
2: 1
3: 25
4: 336
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101442_1002101467 27 Left 1002101442 5:176860077-176860099 CCCCTCCCTGCCCCCACACGCCC 0: 1
1: 2
2: 7
3: 182
4: 1971
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101451_1002101467 15 Left 1002101451 5:176860089-176860111 CCCACACGCCCAGCCAGGGACCC 0: 1
1: 0
2: 2
3: 75
4: 690
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101443_1002101467 26 Left 1002101443 5:176860078-176860100 CCCTCCCTGCCCCCACACGCCCA 0: 1
1: 0
2: 7
3: 104
4: 1257
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101453_1002101467 7 Left 1002101453 5:176860097-176860119 CCCAGCCAGGGACCCCTGCCCAC 0: 1
1: 0
2: 4
3: 55
4: 477
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101456_1002101467 -5 Left 1002101456 5:176860109-176860131 CCCCTGCCCACCCAGCTCCCCCG 0: 1
1: 0
2: 14
3: 360
4: 3449
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101446_1002101467 21 Left 1002101446 5:176860083-176860105 CCTGCCCCCACACGCCCAGCCAG 0: 1
1: 0
2: 3
3: 69
4: 700
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101454_1002101467 6 Left 1002101454 5:176860098-176860120 CCAGCCAGGGACCCCTGCCCACC 0: 1
1: 0
2: 5
3: 77
4: 635
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101441_1002101467 28 Left 1002101441 5:176860076-176860098 CCCCCTCCCTGCCCCCACACGCC 0: 1
1: 1
2: 22
3: 227
4: 2191
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101455_1002101467 2 Left 1002101455 5:176860102-176860124 CCAGGGACCCCTGCCCACCCAGC 0: 1
1: 0
2: 12
3: 95
4: 733
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101445_1002101467 22 Left 1002101445 5:176860082-176860104 CCCTGCCCCCACACGCCCAGCCA 0: 1
1: 0
2: 6
3: 53
4: 732
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101457_1002101467 -6 Left 1002101457 5:176860110-176860132 CCCTGCCCACCCAGCTCCCCCGC 0: 1
1: 0
2: 4
3: 86
4: 938
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101444_1002101467 25 Left 1002101444 5:176860079-176860101 CCTCCCTGCCCCCACACGCCCAG 0: 1
1: 1
2: 9
3: 147
4: 1170
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101458_1002101467 -7 Left 1002101458 5:176860111-176860133 CCTGCCCACCCAGCTCCCCCGCC 0: 1
1: 0
2: 16
3: 158
4: 1791
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205
1002101452_1002101467 14 Left 1002101452 5:176860090-176860112 CCACACGCCCAGCCAGGGACCCC 0: 1
1: 0
2: 5
3: 63
4: 881
Right 1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002101467 Original CRISPR CCCCGCCAAGAGGCAGGCAC AGG Intronic
901791882 1:11658166-11658188 AGCCGCCAAGATGCAGGCAGAGG + Intronic
902096145 1:13947560-13947582 CCCTGACAAGAGGGAGGCAGAGG - Intergenic
904306224 1:29592066-29592088 CCCGGCTCAGAGCCAGGCACAGG - Intergenic
905875768 1:41431288-41431310 CCCCACCCAGGGGCAGGCAGCGG - Intergenic
906209877 1:44006828-44006850 CCCAGCCCAGAGGTTGGCACAGG + Intronic
906565058 1:46793742-46793764 CCCCGCCACCTGACAGGCACCGG + Intronic
906961854 1:50423616-50423638 CCCCTCCCAGAGGCACGCAGTGG - Intergenic
907328126 1:53654002-53654024 CCCCACCATGGGGCAGACACAGG + Intronic
907417708 1:54326009-54326031 CACCGGCCAGAGGCAGGCACAGG + Intronic
909490801 1:76224343-76224365 CCCAGCCCAGAGGAAGGTACTGG + Intronic
910348074 1:86263818-86263840 CCCCTCCAAGTGCCTGGCACCGG + Intergenic
912452222 1:109774185-109774207 CACCGCCAGGATGCAGGCACAGG + Intronic
915476189 1:156154168-156154190 CCCTGCCCAGAGCCAGGCAACGG + Intronic
918341913 1:183574991-183575013 CCCCTTCTAGAGGCAGACACAGG + Intronic
920071828 1:203307684-203307706 CCCCTCCTATAGGCAGACACTGG - Exonic
1063249647 10:4259941-4259963 CCCAGCCCAGAGACAGGCCCTGG - Intergenic
1067436525 10:46282839-46282861 CTCCGCGAAGAGGGAGCCACAGG + Intergenic
1069438321 10:68406635-68406657 CCCCGGCAAGGTGCGGGCACTGG - Intronic
1070768504 10:79069563-79069585 CGCCGGCAGGAGGCGGGCACCGG - Intronic
1075932724 10:126313108-126313130 CCCAGCCAAGCTGCAGGCTCAGG - Intronic
1076173218 10:128340618-128340640 CCGGGTCAAGAGGCAGCCACTGG + Intergenic
1076478073 10:130766419-130766441 TCCAGGCATGAGGCAGGCACTGG + Intergenic
1077097448 11:805063-805085 CCCAGCCCCGAGGCAGGCTCGGG + Intronic
1077124018 11:924671-924693 CCCGGCCAGGAGGAGGGCACAGG - Intergenic
1077384546 11:2262848-2262870 CCCAGCCCAGAGGCAGGGAGGGG - Intergenic
1078570301 11:12452179-12452201 CCCTGCCTGGAGGCAGGCCCTGG - Intronic
1078576521 11:12507543-12507565 CCCAGCCAAGAGGCAGAGGCAGG - Intronic
1082089777 11:48079828-48079850 CCCAACCCAGAAGCAGGCACGGG - Intronic
1082717546 11:56633370-56633392 CACCGCCAAGTGGGAAGCACAGG + Intergenic
1084192188 11:67504324-67504346 GCCCGCCACGAGGGAGGCAGAGG + Intronic
1084538674 11:69773920-69773942 CCCCTCCAAGACCCAGGCACAGG + Intronic
1085460092 11:76688359-76688381 CCGGGCCAAGGGGCAGGCACTGG + Intergenic
1085618876 11:78022711-78022733 CCCAGCCAAGGGGCAGGGGCAGG + Intronic
1090402583 11:126458528-126458550 CCCTGCCTAGTGCCAGGCACGGG + Intronic
1098695098 12:73542496-73542518 CCCTGCCAAAAAGCAGGCAAAGG + Intergenic
1101915528 12:108892909-108892931 TCCCACCAAGAGGGTGGCACAGG - Intronic
1103096438 12:118136389-118136411 CCCACCCAGGAGGCCGGCACAGG - Intronic
1103951797 12:124555392-124555414 CCCGAGCAAGTGGCAGGCACGGG + Intronic
1104349249 12:128030653-128030675 CCCAGCAAAGAGGAAGGAACAGG - Intergenic
1104691405 12:130829099-130829121 CCCCACCATGAGGCAGGTGCTGG + Intronic
1105622331 13:22080360-22080382 ACCCCCCAAAAGGCAGGCAGGGG - Intergenic
1107175456 13:37394229-37394251 CCCCCCCAAGAGGCATGTACTGG - Intergenic
1107644766 13:42482455-42482477 CTCCCCCAAGAGGTAAGCACTGG + Intergenic
1107866201 13:44705793-44705815 CCCTACTAACAGGCAGGCACTGG + Intergenic
1108428930 13:50334467-50334489 GCTGGCCAAGAGGCAGGCAGGGG - Intronic
1113673235 13:112189246-112189268 CCCCGGCTTGAGGCAGGAACTGG - Intergenic
1114440498 14:22742763-22742785 CCCACCAAAGAGGCAGCCACAGG + Intergenic
1118370050 14:65130172-65130194 CATCGCTGAGAGGCAGGCACAGG - Intergenic
1118743800 14:68759799-68759821 CCTCACCAAGAGGCAGGGAAAGG - Intergenic
1121368222 14:93333487-93333509 CACTGCCAAGAAGCAGCCACCGG - Exonic
1122790667 14:104182954-104182976 CCCCAGCAAGAAGCAGGCTCTGG - Intergenic
1124585614 15:31003520-31003542 ACCAGCTAAGAGACAGGCACCGG - Intronic
1129744206 15:78007020-78007042 TCCCGCCCCAAGGCAGGCACGGG - Intronic
1129769065 15:78192216-78192238 GCCCACCAAGAGTCAGACACTGG + Intronic
1132028178 15:98420290-98420312 CCCCACCCAGAGGCAGGTGCTGG + Intergenic
1132588818 16:717549-717571 TCCCGCCAGGAGGCAGGAATTGG - Exonic
1133236372 16:4389160-4389182 CCCAGGCAAGAGGCAGGGCCTGG + Intronic
1133802228 16:9092625-9092647 CCCCGCCCCGAGGCCGGCTCAGG - Intronic
1137249902 16:46733685-46733707 CCCCACCAAGAGGCAGCCAGAGG - Intronic
1139445538 16:66995870-66995892 CCCCACCCAGATGCAGGCATAGG - Intronic
1141110914 16:81270054-81270076 CCCCGCCAGGAGCTAGGCTCAGG - Intronic
1141970009 16:87474827-87474849 GCCCTGCAACAGGCAGGCACGGG + Intronic
1142123341 16:88397965-88397987 CCCTGCCCAGAGCCGGGCACAGG + Intergenic
1142136531 16:88454196-88454218 CCTGGCCAAGTGGCAGGCACCGG + Intronic
1142147962 16:88500272-88500294 CCCGGCCATGCGGCAGGCCCAGG - Intronic
1142222733 16:88863606-88863628 CCCCGCCAAGAGGGGGCCAGTGG + Exonic
1144338918 17:14297275-14297297 CCCTGGCCAGAGGCGGGCACTGG - Intergenic
1144590643 17:16520910-16520932 CCCAGCCAGGAGACAGGCTCTGG - Intergenic
1145064858 17:19755497-19755519 CCCAGCTAAGTGGCAGACACTGG + Intergenic
1147584700 17:41647628-41647650 CTCCTCCCAGAGGCAGGGACAGG + Intergenic
1148366282 17:47057984-47058006 CCCCGGCTACAGGCAGGCATGGG - Intergenic
1151150530 17:72081929-72081951 CCCTGGCAAGAGGCAGGAAAAGG - Intergenic
1151547997 17:74805235-74805257 TCCCTGCAAAAGGCAGGCACGGG - Intronic
1152128009 17:78459066-78459088 GGCGCCCAAGAGGCAGGCACTGG - Exonic
1152429823 17:80242545-80242567 CCCTGCCTGGAGGGAGGCACAGG - Intronic
1152735776 17:81996200-81996222 CCACGCCCACAGGCAGGCAGAGG - Intronic
1157630222 18:49087941-49087963 CCCCATCAAAAAGCAGGCACAGG - Intronic
1160717235 19:581950-581972 CTCCGCGAGGAGGCAGGCAGGGG - Intronic
1161587015 19:5111111-5111133 CCCCGCCAGGAGGCTGACCCTGG + Intronic
1162327491 19:10007601-10007623 TCCCGCCAAGAGGCTGGGGCAGG - Intronic
1164609970 19:29625149-29625171 CACCGCCAGGAGGCAGGAGCTGG - Intergenic
1164836283 19:31357198-31357220 CCGCGCCAAGGGGCAGCCCCAGG - Intergenic
1164958499 19:32406313-32406335 CCCCTGGACGAGGCAGGCACCGG - Intronic
1165101112 19:33439286-33439308 CCCAGCCCAGAGGGAGGCAGGGG - Intronic
1166185642 19:41137164-41137186 CCCAGCCAAGGGGCAGGAGCTGG + Intergenic
1167715484 19:51140314-51140336 CCCCGAAAAAAGGCAGACACTGG + Intergenic
1168352380 19:55684012-55684034 CCAAGCCAAGAGGCAGTCCCAGG - Intronic
926243197 2:11103632-11103654 CCCCTCCAAGACAGAGGCACAGG - Intergenic
933751254 2:85603116-85603138 CCCTGGCCAGAGGCAGGCATGGG - Intronic
936496329 2:113025082-113025104 GCCCTCCAAGAGGGAGGCAGAGG + Intronic
937289802 2:120775519-120775541 CTCCACCCCGAGGCAGGCACTGG - Intronic
938571107 2:132562659-132562681 CACCACCAAGAGGGAGCCACTGG + Intronic
938773596 2:134521823-134521845 CCCTCCTAGGAGGCAGGCACTGG + Intronic
943247387 2:185473210-185473232 CTGCACCAAGAGGCAGCCACAGG - Intergenic
944221815 2:197310760-197310782 TCCCGCCGAGAGGCTGACACTGG + Exonic
944512816 2:200481462-200481484 CCCCACCCCGACGCAGGCACAGG + Exonic
945776694 2:214114599-214114621 CCCTGCCCCGAGCCAGGCACAGG + Intronic
946158838 2:217823749-217823771 GTCTGCAAAGAGGCAGGCACGGG + Intronic
946388189 2:219398866-219398888 CCCCTCCAGGTGGCAGGCACAGG + Intronic
947546544 2:231014691-231014713 ACCCACCAAGAGGCTGACACAGG + Intronic
947716055 2:232339361-232339383 CGCCGCCAGGAGGCAGGAAGTGG + Intronic
947735079 2:232450102-232450124 CACCGCCACGAGGCAGGAAGTGG + Intergenic
947743299 2:232494766-232494788 CCTCCCCAAGAGGCTGTCACAGG - Intergenic
948477689 2:238231107-238231129 CACTGCCCAGAGGCAGACACTGG - Intronic
948859574 2:240746314-240746336 CCCCCCTACAAGGCAGGCACAGG - Intronic
1171023621 20:21608762-21608784 CCCATCCAAGAGGCTGGCAGTGG - Intergenic
1172771906 20:37386873-37386895 CCAGGCCAAGAGTCAGGCAGTGG + Intronic
1173320602 20:41983866-41983888 TCCAGCCAAGACCCAGGCACTGG + Intergenic
1173473672 20:43343017-43343039 ACCTGCCAAGAGGCAGGAAAAGG + Intergenic
1173730127 20:45322499-45322521 CCCGGCCAAAATGTAGGCACAGG - Intergenic
1174038746 20:47684400-47684422 GCCCACCAAGAGGCATGCAGCGG + Intronic
1174199376 20:48796507-48796529 CCCTCCCCAGAGGCAGCCACTGG - Intronic
1174286861 20:49480218-49480240 CCCAGAGAAGAAGCAGGCACAGG - Intronic
1174383529 20:50172526-50172548 CTCCGCAAAGCGGGAGGCACAGG - Intergenic
1174418902 20:50386381-50386403 AACAGCCAAGAGGCAGGCACAGG - Intergenic
1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG + Intergenic
1175926053 20:62472183-62472205 TCCCTCCGAGAGGCAGGCATGGG + Intronic
1176051257 20:63120781-63120803 CCCCGTCAAGGGGCAGGGGCAGG + Intergenic
1176120468 20:63452300-63452322 CTCAGCTCAGAGGCAGGCACTGG - Intronic
1176261313 20:64182328-64182350 CCCAGCCAATACGCACGCACAGG + Intronic
1180093033 21:45542361-45542383 CCCCGCCGAGTCGCAGGTACCGG - Exonic
1180840034 22:18954886-18954908 CCCAGCCAAGATGCCAGCACAGG + Intergenic
1180925913 22:19554947-19554969 CTCCCCCCAGAGGCAGGCATGGG + Intergenic
1181061866 22:20285594-20285616 CCCAGCCAAGATGCCAGCACAGG - Intergenic
1181236020 22:21448142-21448164 CCCAGCCTGGAGCCAGGCACTGG + Exonic
1182073537 22:27479403-27479425 GCCCCCCAGGAGACAGGCACAGG + Intergenic
1182230686 22:28835687-28835709 CCCCTCCCAGAGTCAGGCATGGG - Intergenic
1183380990 22:37490471-37490493 GCCCCCCAAGAGGGAGGCATAGG + Exonic
1184119643 22:42441454-42441476 CCTCGCCATGAGGGAGGCCCAGG - Intergenic
1184265490 22:43343691-43343713 CCCGGCCCAGAGGCAGCCTCGGG + Intergenic
1184693985 22:46129793-46129815 CCCAGGCAGGAGGCTGGCACTGG - Intergenic
1185027783 22:48425412-48425434 CCCGGACAGGAGGGAGGCACTGG + Intergenic
950357824 3:12426483-12426505 CCCCAGCAAGATGCAGGCCCAGG + Intronic
952484650 3:33798296-33798318 CCTCCCCAAGAGGCAGTCCCAGG - Intergenic
952857501 3:37784336-37784358 CCCCAGCCAGAGGCAGGCAGAGG - Intronic
953703180 3:45212229-45212251 CCCCGCCATGAGGCAGGTGATGG - Intergenic
953766399 3:45746800-45746822 CCCCGCTATGAGGCAGACCCTGG - Intergenic
953885196 3:46711094-46711116 CCCATCCCGGAGGCAGGCACAGG + Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954335282 3:49912682-49912704 CCCTGCCCTGAGGCAGTCACAGG - Intronic
956723103 3:72135529-72135551 CCCAGCGAGGAGGCAGGGACTGG - Intergenic
958265441 3:91432679-91432701 TCCAGCCAAGAGCCAGGCTCAGG - Intergenic
962200430 3:133396744-133396766 CCTCTCCAAGAGAAAGGCACGGG - Exonic
962396136 3:135016722-135016744 CCCAGGCAAGAGGAAGGAACTGG - Intronic
963841095 3:150107217-150107239 CCCCACCAAATGGCAGGCCCAGG + Intergenic
964514775 3:157495956-157495978 CCCAACCAAGAGGTAAGCACTGG - Intronic
967065363 3:185910560-185910582 CCCAGCCCAGGGGCAGGCTCTGG - Intergenic
968641531 4:1717349-1717371 ACCTGCCAGGAGGCAGCCACAGG - Exonic
969348080 4:6581644-6581666 CCCTGCCTCGAGGCAGGCCCTGG + Intronic
969606515 4:8204828-8204850 CCCAGCAAAGAGGCAGTGACCGG + Intronic
970313183 4:14804256-14804278 CCACACCAAGAGGCAGGCTGAGG + Intergenic
979957559 4:126973331-126973353 CCTCTCCAAGAGGCAGGAAAAGG + Intergenic
981550206 4:145936186-145936208 CCCCGACAAGAGCCCGGCAGCGG + Intronic
981712555 4:147723609-147723631 CCCTAGCATGAGGCAGGCACAGG + Intergenic
981868621 4:149459307-149459329 ACCTGCCAAGTGCCAGGCACTGG - Intergenic
982565479 4:156980561-156980583 CCCAGCCAAGATCCAAGCACTGG + Intergenic
983561263 4:169104070-169104092 CCCCTCTAAGAGGAAGGGACCGG + Intronic
985629115 5:1005603-1005625 CCCCTGGAAGAGGCAGGCAGGGG + Intergenic
988382241 5:30512765-30512787 CTCCCCCAATAGGAAGGCACTGG - Intergenic
988629450 5:32913256-32913278 CCCTGCAGAGAGGCAGGCTCCGG - Intergenic
998388966 5:141774634-141774656 TCCAGCCAAGATGCAGGCCCAGG - Intergenic
999407552 5:151320657-151320679 CTCAGCCAATAGGCAAGCACAGG + Intronic
1000097708 5:157986202-157986224 CCCAGCCAAGGGGCTGGCTCTGG - Intergenic
1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG + Intronic
1002536534 5:179879101-179879123 CACAGCCAAGACGCGGGCACTGG - Exonic
1003161100 6:3635503-3635525 CCCTGCCACGTGGCAGGCTCCGG - Intergenic
1004455445 6:15787751-15787773 CCGGGCCAAGAGGCAGGAAACGG + Intergenic
1006755173 6:36409401-36409423 CCCCACCAAGACGCAGAGACTGG + Intronic
1006845006 6:37055956-37055978 CCCCGCCGAGAGGAAGGGAGGGG + Intergenic
1008989927 6:57589977-57589999 TCCAGCCAAGAGCCAGGCTCAGG + Intronic
1009178509 6:60488517-60488539 TCCAGCCAAGAGCCAGGCTCAGG + Intergenic
1010125964 6:72432073-72432095 CTAAGCCAAGAGGGAGGCACGGG + Intergenic
1011022822 6:82833272-82833294 CCCCACCCAGAGGCAGACTCAGG - Intergenic
1017497534 6:154995211-154995233 CCCCGCCCAGCGTCAGGCCCAGG - Intronic
1017883239 6:158576577-158576599 ACCTGCCCAGAGGAAGGCACAGG + Intronic
1019461221 7:1159957-1159979 CCCCGACGAGAGCCAGGTACGGG - Exonic
1019685319 7:2378891-2378913 CCCCCCCAGGAGGGATGCACTGG + Intronic
1023874373 7:44278719-44278741 CCACCCCAAGAGGCAGGCTGGGG + Intronic
1024604446 7:51012675-51012697 CAGTGCCAGGAGGCAGGCACTGG - Intergenic
1025252111 7:57358615-57358637 AACAGCCAGGAGGCAGGCACAGG + Intergenic
1027234267 7:76288557-76288579 CCCTAGCCAGAGGCAGGCACGGG - Intergenic
1029219092 7:98973868-98973890 CCCTGCTAAGAGGCGGGCACAGG - Intronic
1029903136 7:104063381-104063403 CCCCACCAAATGACAGGCACTGG + Intergenic
1031073643 7:117190841-117190863 CCCCGCCGAGATGCAGCCTCAGG - Exonic
1031237813 7:119198237-119198259 CCCCTCTAGGAGGCAGGTACAGG + Intergenic
1033646039 7:143305089-143305111 CCACGCCAAGTGGAAGCCACTGG + Exonic
1039563242 8:38529687-38529709 GCCAGCCAAGAGCTAGGCACAGG - Intergenic
1042829197 8:73008691-73008713 CAACGCCCAGAGGCAGGAACAGG + Intergenic
1044609870 8:94080717-94080739 CCCCGGCCAGTGGCAGGCAGAGG - Intergenic
1045063980 8:98429151-98429173 GCCTGCCAAGATGCAGGCAGAGG - Exonic
1045794666 8:106028614-106028636 CCCCACCAAAAAGCAGGCAAAGG + Intergenic
1049250026 8:141583231-141583253 GCGCTCCAAGAGGCAGTCACAGG - Intergenic
1049685481 8:143937635-143937657 CCCGCCCAAGAGCCAGGCAGGGG + Intronic
1049783869 8:144441217-144441239 CCACACCAACAGGCAGGCAGAGG - Intronic
1050358280 9:4804063-4804085 CTCCTCCAAGATGCAGGAACAGG + Intronic
1053009696 9:34625963-34625985 CTCCGCCTAGGGGCAGGCAGGGG + Intronic
1053165117 9:35839132-35839154 CCCCACCCAGAGCCTGGCACTGG + Intronic
1057081501 9:92177418-92177440 CCCCACCAGGACCCAGGCACTGG + Intergenic
1057190556 9:93084682-93084704 GCCAGCCCAGAGGCAGGCAGGGG - Exonic
1057215019 9:93223249-93223271 CTTGGACAAGAGGCAGGCACTGG - Intronic
1057233013 9:93336274-93336296 CCCCACCAAGTTGCAGGCAGAGG - Intronic
1057252499 9:93515347-93515369 CCCCACCAAGTTGCAGGCAGAGG + Intronic
1059387137 9:113973364-113973386 CCAGGCCAAGAGGAAGGCGCTGG - Intronic
1061128327 9:128690106-128690128 CCCCGCCCAGAGGCTGGCCCCGG + Intronic
1061377930 9:130237009-130237031 CTCCCCCAAGTGGCAGGCTCCGG - Exonic
1061474687 9:130856621-130856643 TCCTGCCCAGAGGCAAGCACTGG + Intronic
1061514440 9:131080652-131080674 CCCGGGTAAGCGGCAGGCACTGG - Intronic
1062013615 9:134280331-134280353 CCCCACCAAGATCCAGACACAGG + Intergenic
1062177853 9:135174275-135174297 CCCTGACCAGAGCCAGGCACAGG - Intergenic
1203791503 EBV:154089-154111 CCCCGCCAACCTGCAGGCCCTGG - Intergenic
1188892330 X:35626029-35626051 CACCAGCAAGAGGCAGGCAGTGG + Intergenic
1189702968 X:43730880-43730902 CCCTGAGAAGGGGCAGGCACAGG - Intronic
1189884970 X:45533207-45533229 CTCCCCCAACATGCAGGCACTGG - Intergenic
1190227917 X:48560253-48560275 CCCAGCCAAGTGGCAGACGCTGG + Exonic
1191256811 X:58283093-58283115 CCCCGCCCCGTGTCAGGCACAGG + Intergenic
1199996352 X:153029019-153029041 CCCCGCCAAATAGCAGGCAAAGG + Intergenic
1200034832 X:153320430-153320452 CCCCGCCAAATAGCAGGCAAAGG - Intergenic