ID: 1002102076

View in Genome Browser
Species Human (GRCh38)
Location 5:176862625-176862647
Sequence TGCCCAGCAGAGTGCCACCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002102072_1002102076 -5 Left 1002102072 5:176862607-176862629 CCTCTGCCCTGCCGCAGGTGCCC 0: 1
1: 0
2: 2
3: 40
4: 487
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102066_1002102076 11 Left 1002102066 5:176862591-176862613 CCTGGCTCACCTTCCCCCTCTGC 0: 1
1: 0
2: 8
3: 93
4: 949
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102065_1002102076 12 Left 1002102065 5:176862590-176862612 CCCTGGCTCACCTTCCCCCTCTG 0: 1
1: 1
2: 3
3: 86
4: 744
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102067_1002102076 2 Left 1002102067 5:176862600-176862622 CCTTCCCCCTCTGCCCTGCCGCA 0: 1
1: 0
2: 5
3: 74
4: 764
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102070_1002102076 -3 Left 1002102070 5:176862605-176862627 CCCCTCTGCCCTGCCGCAGGTGC 0: 1
1: 0
2: 2
3: 45
4: 415
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102064_1002102076 13 Left 1002102064 5:176862589-176862611 CCCCTGGCTCACCTTCCCCCTCT 0: 1
1: 0
2: 4
3: 81
4: 881
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102063_1002102076 22 Left 1002102063 5:176862580-176862602 CCAGTCTGGCCCCTGGCTCACCT 0: 1
1: 0
2: 4
3: 46
4: 324
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102061_1002102076 27 Left 1002102061 5:176862575-176862597 CCTGCCCAGTCTGGCCCCTGGCT 0: 1
1: 0
2: 1
3: 53
4: 494
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102062_1002102076 23 Left 1002102062 5:176862579-176862601 CCCAGTCTGGCCCCTGGCTCACC 0: 1
1: 0
2: 2
3: 31
4: 311
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102071_1002102076 -4 Left 1002102071 5:176862606-176862628 CCCTCTGCCCTGCCGCAGGTGCC 0: 1
1: 0
2: 2
3: 32
4: 314
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102069_1002102076 -2 Left 1002102069 5:176862604-176862626 CCCCCTCTGCCCTGCCGCAGGTG 0: 1
1: 0
2: 5
3: 37
4: 383
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1002102060_1002102076 28 Left 1002102060 5:176862574-176862596 CCCTGCCCAGTCTGGCCCCTGGC 0: 1
1: 0
2: 7
3: 76
4: 622
Right 1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002102076 Original CRISPR TGCCCAGCAGAGTGCCACCG TGG Exonic
900649059 1:3722231-3722253 TGCTGGGCAAAGTGCCACCGTGG - Intronic
902979474 1:20112856-20112878 TGGCCAGGAGAGTGACACCATGG - Exonic
904031489 1:27536203-27536225 TGCCCAGCAGACAGCAGCCGAGG - Intronic
905371675 1:37485806-37485828 TGCCAGGCAGAGTGACTCCGAGG + Intergenic
905620104 1:39437887-39437909 TGACAATAAGAGTGCCACCGTGG + Exonic
905873082 1:41416116-41416138 TGCCCAGCAGGGGCCCACCAGGG + Intergenic
905933573 1:41806687-41806709 TGCCCACTGGAGTGCCACAGAGG - Intronic
906795514 1:48693604-48693626 TGCCCAGCAGAGTGCCCATCTGG - Intronic
907879213 1:58529258-58529280 TTCCCATCAGAGTGCCATCTGGG - Intronic
915368079 1:155326469-155326491 TGCCCAGCAGAGTGAGGCCTGGG + Intronic
918356025 1:183707164-183707186 TGCCCAGCCTAGTGACACAGAGG - Intronic
918356251 1:183708572-183708594 TGCCCAGCCTAGTGACACAGAGG + Intronic
918697423 1:187560919-187560941 GGCCCACCTGAGTGCCACTGGGG - Intergenic
919944023 1:202306976-202306998 TGCCTAGCAGAGGGACACGGTGG - Intronic
922898754 1:229120421-229120443 TACCCCTCAGAGTGCCCCCGTGG - Intergenic
923039699 1:230310748-230310770 TGCCCAGCAGAGGGCAGCAGAGG - Intergenic
923086281 1:230705794-230705816 TGCCCAGCCCCGTGCCACCGCGG + Intronic
924382346 1:243475925-243475947 TGCCCAGTTGTGTGCCACTGTGG - Intronic
1064140435 10:12785589-12785611 TGCCCAGCACAGTCCCTCCGGGG - Intronic
1064798393 10:19040119-19040141 TGCTCAACAGAGGGCCACAGAGG + Intergenic
1067060313 10:43074985-43075007 TGCCCAGCAGAGGGGAAGCGAGG - Intergenic
1067296271 10:44976803-44976825 TAGCCAGCAGAGTGCCCCAGTGG + Exonic
1069782011 10:70962828-70962850 TCCCCAGCAGAGGGGCAACGGGG - Intergenic
1072628951 10:97132508-97132530 TGTCCAGCTGATTGCCACCTTGG + Intronic
1074159076 10:110822280-110822302 TGCACAGCAGAGGGCCACCCAGG + Intronic
1076699754 10:132265283-132265305 TGCCCAGCAGAGTGTCCCCCGGG - Intronic
1076810943 10:132886038-132886060 TGCCCATCACAGTGCCCCTGAGG + Intronic
1077304871 11:1864512-1864534 TGCCCATCAGCGCGCCACAGAGG + Intronic
1077434731 11:2533361-2533383 TGCCCAGCAGATTTCCGACGTGG - Intronic
1077872313 11:6272200-6272222 TGCACAGCAGTGTGCAACAGTGG - Intergenic
1077957015 11:7031380-7031402 TGCCCAGAAGTGTCCCACCCTGG - Intronic
1080834498 11:35927823-35927845 TGCCTAGCACTGTGCCACAGGGG - Intergenic
1081780942 11:45712187-45712209 TGCCTAGCTGAGTACCACTGTGG + Intergenic
1083852978 11:65378688-65378710 TGCCCAGGAGAGGGCGACCCTGG + Intronic
1084211927 11:67628385-67628407 TCCCCAGCAAAAGGCCACCGTGG - Exonic
1085135736 11:74086099-74086121 TGCCCATCAGAGTGACTCTGAGG + Intronic
1085802604 11:79604366-79604388 TGACCAGCAGAGTGACAGCCAGG - Intergenic
1090102545 11:123815345-123815367 TGCCAAGCAGGGTGACACGGCGG - Intergenic
1094170499 12:27486253-27486275 TGCCCAGCAGAGTGCCAAAGAGG - Intronic
1096216122 12:49798357-49798379 TGCCCAGCACAGTGCCCCAGAGG + Exonic
1101334493 12:103784451-103784473 TCCCAAGCAGAGTGCCAGCTGGG + Intronic
1103343686 12:120235270-120235292 AGCCCAGCAGAGTGCCAAAAAGG + Intronic
1104954711 12:132458574-132458596 GACCCAGCAGAGTGCAGCCGGGG - Intergenic
1105405272 13:20128008-20128030 TGCCCGCCAGTGTGCGACCGCGG + Intergenic
1113652235 13:112042172-112042194 TGCCCAGAAGAGTCCCAGAGAGG + Intergenic
1121016447 14:90552186-90552208 TGCCCGTCAGAGCTCCACCGTGG + Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1122549776 14:102543662-102543684 TGCCCAGCAGTGTGACAGCCTGG - Intergenic
1123414383 15:20084277-20084299 TGCTTAGCAGAGTGCCAAGGAGG - Intergenic
1123523725 15:21091388-21091410 TGCTTAGCAGAGTGCCAAGGAGG - Intergenic
1125714479 15:41811578-41811600 AGCCCAGCAGGGGGCCCCCGGGG - Intronic
1128358401 15:66944041-66944063 GGCCCAGCACAGTGCCTCTGGGG - Intergenic
1132870523 16:2113774-2113796 TACCCAGCATGGTGGCACCGCGG + Intronic
1132944664 16:2526328-2526350 TGCTCAGCAGGGTGCCAGCCAGG - Intronic
1134522010 16:14923130-14923152 TACCCAGCATGGTGGCACCGCGG - Intronic
1134716892 16:16361810-16361832 TACCCAGCATGGTGGCACCGCGG - Intergenic
1134957859 16:18390349-18390371 TACCCAGCATGGTGGCACCGCGG + Intergenic
1141702913 16:85650629-85650651 GCCCCAGCAGTGTACCACCGCGG + Intronic
1147132512 17:38417857-38417879 TGCCCACCAGATTGCCACCAGGG + Intergenic
1148124239 17:45228784-45228806 AGCCCAGCACAGAGCCACAGAGG - Intronic
1150590839 17:66560813-66560835 TGCCCAGCAGAATGACATCCAGG - Intronic
1151395554 17:73820262-73820284 TGCCCAGCAGCCCGCCACCCTGG - Intergenic
1151522800 17:74642463-74642485 AGCCCAGCAGGGTGGCACCTGGG + Intergenic
1152111341 17:78359287-78359309 GGCCCAGGAGAGGGCCCCCGGGG - Intronic
1152371000 17:79888567-79888589 GGCACAGCTGAGTGGCACCGTGG + Intergenic
1152496154 17:80673439-80673461 TGCCCAGGAAAGTGTCACCAGGG - Intronic
1152569727 17:81116382-81116404 GGCCCAGGAGAGCCCCACCGAGG - Exonic
1154310198 18:13261418-13261440 TGCCCAGCACAGTGCCTGCCTGG + Intronic
1157587939 18:48817150-48817172 TGCACAGCAGGGTGGCACCCAGG + Intronic
1158224019 18:55182024-55182046 GCCCCAGCACAGTGCCACCCAGG + Intergenic
1158328235 18:56333023-56333045 TGCCCAGCAGTGGGTCACTGGGG + Intergenic
1165695631 19:37898851-37898873 TGGCCAGCAGAGGGCAACGGAGG + Intronic
1166716935 19:44974488-44974510 TTCCCAGAAGAGTGCCGACGTGG - Exonic
925484846 2:4316575-4316597 TGCCCCACATAGTGCCACCAGGG + Intergenic
927030041 2:19111332-19111354 TGCCCAGCAGAGAGCCATTCTGG - Intergenic
928053548 2:28027130-28027152 TGCACAGCAGGGTGCCAGTGTGG - Intronic
928904751 2:36356754-36356776 CCCCCAGGAGAGTGCCCCCGCGG + Intronic
932336801 2:70936205-70936227 TGTCCAGCAGAGTGACGCAGTGG + Intronic
934716942 2:96549938-96549960 TGAGCAGCAGAGTACCAGCGGGG - Intronic
934863824 2:97788231-97788253 GGCCCAGCCGAGGGCCACTGAGG - Intronic
937456011 2:122042346-122042368 TGCCCAACAGAGTGCCATGTCGG + Intergenic
939971827 2:148670732-148670754 TGGGCAGCAGAGTGAGACCGAGG - Intronic
942178798 2:173360041-173360063 TGCTCAGAAGAGTGGGACCGAGG - Intronic
942458890 2:176156388-176156410 GGCCCAGCAGAATGCCAACCTGG - Intronic
946187753 2:217990852-217990874 TGCACAGCAGAGTCCCAGCCTGG + Intronic
948159086 2:235809456-235809478 GTCCCAGCAAAGTGCCCCCGTGG + Intronic
948186555 2:236026022-236026044 TGCCCAGCAGAGTGAAGCCAGGG - Intronic
948191937 2:236065960-236065982 TGCCGACCACAGTGCCACCCTGG - Intronic
948295589 2:236857844-236857866 TCCTCAGCAGACTGCCACCCTGG - Intergenic
948649331 2:239430226-239430248 TGTCCAGCCAAGAGCCACCGCGG - Intergenic
948837972 2:240635517-240635539 TGCCCAGTAGAGTGTCCACGAGG + Intergenic
1168768371 20:397441-397463 TCCCCAGAAGAGTCCCACCTGGG - Exonic
1171349218 20:24490156-24490178 GGCCCAGCGGAGTGCCTCTGCGG + Intronic
1174243123 20:49154190-49154212 TGCCTAGCAGTGAGCCACCCAGG - Intronic
1174699282 20:52591171-52591193 TGCCCAGCAGGGTGCCACTTGGG + Intergenic
1174919182 20:54683494-54683516 TGCCCAGAAGAGTGTCAGGGAGG - Intergenic
1175471111 20:59229372-59229394 TGGCCAGCAGAATGCAACAGAGG - Intronic
1179172085 21:38980707-38980729 TTCCCCGCAGAGTGGCACCATGG - Intergenic
1181300172 22:21874372-21874394 GAACCAGCAGAGTGGCACCGGGG - Intergenic
1182127299 22:27825347-27825369 TGCGCAGCAGAGTGCCAGCAGGG - Intergenic
1182150880 22:28026318-28026340 TGCCCAGCAGACAGCCTCCTGGG + Intronic
1182545730 22:31075290-31075312 TGCTTAGCAGAGTGCCAAGGAGG + Intronic
1183705771 22:39474164-39474186 GGCCTTGCAGTGTGCCACCGGGG + Intronic
1184423424 22:44395191-44395213 TGCCCAGCATAGTGGCTCTGAGG - Intergenic
950151111 3:10688305-10688327 AGCCCAGCAGAGGGCCCCAGTGG + Intronic
951543957 3:23806966-23806988 TGCCCAGCGGAGAGCCCCGGGGG + Intronic
951706176 3:25546289-25546311 TGCGCAGAAGAGTGCCACACTGG + Intronic
953795784 3:45984977-45984999 TGCTGAGCAGACAGCCACCGAGG - Exonic
961502070 3:127343209-127343231 TCCCCTCCTGAGTGCCACCGAGG - Intergenic
967942900 3:194779977-194779999 TGCCCAGCCTGGTGCCAACGTGG + Intergenic
968266521 3:197367419-197367441 GGGCCAGCAGAGTCCCAGCGTGG - Intergenic
969122667 4:4921344-4921366 TGCACAGCAGACAGCCACTGGGG + Intergenic
969262291 4:6041609-6041631 TGCCAAGCACAGTGCAACCCTGG + Intronic
971236049 4:24843373-24843395 TGCCCAGTACAGTGCCACTCCGG - Intronic
975202187 4:71604583-71604605 TTACCAGCAGAGTGACACTGGGG + Intergenic
975892153 4:79042692-79042714 CACCCAACAGAGTGGCACCGTGG - Intergenic
979353163 4:119669890-119669912 TACTCAGCAGAGTGCCAACGCGG + Intergenic
984767351 4:183409795-183409817 GGCCGAGCACAGAGCCACCGAGG - Intergenic
996466638 5:123810316-123810338 ATCCAAGCAGAGTGACACCGGGG - Intergenic
998394320 5:141808694-141808716 TCCCCTGCTCAGTGCCACCGGGG - Intergenic
999077360 5:148808952-148808974 TGCTCAGCAGAGCGCCACTTTGG - Intergenic
1001379684 5:171296023-171296045 TGCCCAGTAGTGTGTCACTGGGG + Intronic
1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG + Exonic
1006294477 6:33163988-33164010 TGCCCAGCAGAGGCACACGGTGG - Intronic
1007636940 6:43305374-43305396 TGCCCTGCAGGGTGCCTCGGAGG - Exonic
1013355134 6:109339819-109339841 TGCCCAGCTGGGAGCCACGGAGG - Intergenic
1013374164 6:109498015-109498037 TGCCAATCAGAAGGCCACCGAGG + Intronic
1017725719 6:157274861-157274883 CGCCCAGCAGAGGGCGGCCGAGG - Intergenic
1019116630 6:169769409-169769431 TCCCCAGCAGAGTCCCACCCAGG + Intronic
1019713368 7:2527366-2527388 TGCCCAGCAGCCTGCTACCCGGG - Exonic
1022840769 7:34161735-34161757 TGCCTAGTAGACTGGCACCGAGG + Intergenic
1030983152 7:116210372-116210394 TGCCCAGCAGGGCGCCGCCTCGG + Intergenic
1033264811 7:139875833-139875855 AGGCCAGCAGAGTCCCCCCGTGG - Intronic
1034922305 7:155093960-155093982 TCCCCAGCTGGGTGCCACCCTGG + Intergenic
1034993417 7:155562349-155562371 TCCCCACCAGAGTGGCACAGTGG - Intergenic
1035678909 8:1473328-1473350 CGCCCAGCAGACTGCCACTCAGG + Intergenic
1037201036 8:16252185-16252207 TGCCAAGAAAAGTGCCACAGAGG - Intronic
1038194204 8:25351721-25351743 TTCCCTGCAGGGTGCCACTGCGG + Exonic
1041212776 8:55569414-55569436 TACCCAGCTGAGGGCCACAGAGG + Intergenic
1044724574 8:95182676-95182698 TGGAAAGCAGTGTGCCACCGAGG + Intergenic
1045651031 8:104341788-104341810 TCCACAGCAGAGTACCACCAAGG - Intronic
1052970172 9:34372544-34372566 AGCCCAGCAGGGCGCCATCGCGG + Exonic
1055161675 9:73136933-73136955 TGCTCAGCAAAGTGCCAATGAGG + Intergenic
1055562530 9:77535129-77535151 GGCCAAGCAGAGTGCCCCCAAGG - Intronic
1060305510 9:122407251-122407273 TACCCAACAGAATGCCACCCAGG - Intergenic
1061589861 9:131591342-131591364 TGCCCAGCAGATGGCAGCCGTGG + Intronic
1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG + Intergenic
1188938943 X:36213545-36213567 TGCACAGCATAATGCCACCATGG + Intergenic
1197706453 X:129637951-129637973 TGCCCAGCCTAGAGCCACAGAGG + Intergenic