ID: 1002103840

View in Genome Browser
Species Human (GRCh38)
Location 5:176870219-176870241
Sequence GTGCATCGTGGGCCTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002103829_1002103840 27 Left 1002103829 5:176870169-176870191 CCTCCCTGTCATTAGCATGCGTC 0: 1
1: 0
2: 2
3: 5
4: 37
Right 1002103840 5:176870219-176870241 GTGCATCGTGGGCCTGGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 256
1002103836_1002103840 -3 Left 1002103836 5:176870199-176870221 CCAGCTGGACACTAGAGGGCGTG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1002103840 5:176870219-176870241 GTGCATCGTGGGCCTGGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 256
1002103831_1002103840 23 Left 1002103831 5:176870173-176870195 CCTGTCATTAGCATGCGTCATCA 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1002103840 5:176870219-176870241 GTGCATCGTGGGCCTGGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 256
1002103830_1002103840 24 Left 1002103830 5:176870172-176870194 CCCTGTCATTAGCATGCGTCATC 0: 1
1: 0
2: 2
3: 5
4: 67
Right 1002103840 5:176870219-176870241 GTGCATCGTGGGCCTGGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002103840 Original CRISPR GTGCATCGTGGGCCTGGCCC TGG Intronic
900090854 1:919828-919850 CTGCAGCCTGGACCTGGCCCGGG - Intergenic
900289719 1:1918816-1918838 GGGCCTGGCGGGCCTGGCCCCGG + Intronic
902778650 1:18690659-18690681 TTGCTTCCTGGGCCTGGGCCTGG - Intronic
903353103 1:22730101-22730123 AGGCATCATGGGCCTGGCCTTGG + Intronic
905083108 1:35342964-35342986 GAGAATCCTGAGCCTGGCCCAGG + Intronic
905570940 1:39004945-39004967 GTGCTGCCGGGGCCTGGCCCAGG - Exonic
905643986 1:39611781-39611803 GTGGATCCTGTGCCTGGCCGTGG + Intergenic
907158489 1:52355076-52355098 GAGCATCGCGGTCCTGGCCTTGG + Intronic
910623700 1:89284310-89284332 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
910674821 1:89806180-89806202 GTGCATCGTGTGTCATGCCCTGG - Intronic
912017620 1:105061063-105061085 GTGGGCCCTGGGCCTGGCCCAGG + Intergenic
912279488 1:108297968-108297990 GGGGACCCTGGGCCTGGCCCAGG + Intergenic
912288738 1:108396389-108396411 GGGGACCCTGGGCCTGGCCCAGG - Intronic
912511935 1:110195528-110195550 GTGCAGGGTGGGCAGGGCCCTGG - Intronic
918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG + Exonic
921179931 1:212624369-212624391 GGGCATTGTGGCCCTGGCCTGGG + Intergenic
921376581 1:214480564-214480586 GTGAATCTTAGGCATGGCCCTGG + Intronic
922035098 1:221840154-221840176 GTGTGTCATGGGCCTGTCCCAGG - Intergenic
923461177 1:234210963-234210985 GGGGACCCTGGGCCTGGCCCAGG - Intronic
924272482 1:242348209-242348231 GTGCATCGTGATCTTTGCCCTGG - Exonic
1062847998 10:722657-722679 GGGCACCGTGGTCCTGGGCCAGG + Intergenic
1062960995 10:1573605-1573627 GTGCAGAGTGCGCCTGGGCCTGG - Intronic
1063427185 10:5959676-5959698 GTGCTGGGTGGTCCTGGCCCAGG - Intronic
1064207282 10:13334997-13335019 GTGCATGGTGGTCTTGGCGCAGG - Intronic
1065189247 10:23195239-23195261 GTGCGGCGCAGGCCTGGCCCAGG + Intergenic
1066654537 10:37686056-37686078 GTGCATCCAGGGCTGGGCCCAGG + Intergenic
1067513113 10:46911621-46911643 GTGGGTTGTGGCCCTGGCCCGGG + Intronic
1067588944 10:47493691-47493713 GGCCATGGTGGGCCTGGCTCTGG - Intergenic
1067649140 10:48140221-48140243 GTGGGTTGTGGCCCTGGCCCGGG - Intergenic
1069069979 10:63983170-63983192 TTGTATTGTGGGCCGGGCCCAGG + Intergenic
1070600993 10:77866185-77866207 GTGCCTGGTGGGGCTGGCCCTGG - Intronic
1075217806 10:120553838-120553860 GTTTCTCGTGGGCCAGGCCCAGG - Intronic
1075714441 10:124547982-124548004 GTGCCTGGTGAGCCTGGGCCGGG + Intronic
1075831733 10:125417787-125417809 GTGCAGGGTGGGACTGGCACAGG + Intergenic
1076658184 10:132037848-132037870 CTGCCCCGGGGGCCTGGCCCAGG + Intergenic
1076685770 10:132197861-132197883 GTGCAGCCGGGGCCTGGCCTTGG - Intronic
1076708237 10:132314081-132314103 GTGCATCGCGGTGCTGGCCGAGG - Intronic
1076785141 10:132745835-132745857 GGGCATGGTGGGCCCGGCCATGG + Intronic
1076857100 10:133122747-133122769 GTGCCTCCCTGGCCTGGCCCTGG + Intronic
1076909505 10:133379911-133379933 GGCCAGCGTGGGCGTGGCCCAGG + Intronic
1076994242 11:290484-290506 GTCCATCGCCCGCCTGGCCCCGG + Exonic
1078463045 11:11530068-11530090 GGGGATGGAGGGCCTGGCCCTGG - Intronic
1080341766 11:31273058-31273080 ATGGTTCGTGGGCCGGGCCCAGG - Intronic
1081757431 11:45554530-45554552 CTGCACCTTGGGCCAGGCCCTGG - Intergenic
1081857343 11:46312221-46312243 GAGCATTGTGTGCCTTGCCCAGG + Intronic
1083340285 11:61954940-61954962 GAGCATCATGGACCTGGCTCAGG + Intronic
1083640886 11:64144664-64144686 TAGCAACATGGGCCTGGCCCTGG - Intronic
1084598719 11:70132459-70132481 GTGCCTCCGGGACCTGGCCCAGG - Intronic
1090208159 11:124897025-124897047 GGCCATCGTGGGCATGTCCCCGG + Exonic
1091091508 11:132775686-132775708 GTACCTCGGGTGCCTGGCCCTGG + Intronic
1091778343 12:3199092-3199114 TTTCTTCGAGGGCCTGGCCCAGG + Intronic
1094399849 12:30050743-30050765 GTACATCCTGGGCTTGGGCCTGG - Intergenic
1096473037 12:51890765-51890787 GGGCAACCTGGGCCTGGGCCTGG - Exonic
1097009140 12:55940205-55940227 CTACATCCTGGCCCTGGCCCTGG + Intronic
1097404862 12:59177102-59177124 GTGGACCCTGGGCCCGGCCCAGG + Intergenic
1102639330 12:114352719-114352741 GTGCATTGTGTGCCTTGCCATGG + Intergenic
1103343800 12:120235867-120235889 GTGCAAGATGGGCCTGCCCCGGG + Intronic
1103909628 12:124345136-124345158 GCGCACCCTGGGCCTGACCCTGG + Intronic
1104791131 12:131482808-131482830 GTGCCTCGCTGGGCTGGCCCAGG - Intergenic
1106614687 13:31315807-31315829 TGGTTTCGTGGGCCTGGCCCAGG + Intronic
1108724351 13:53163809-53163831 GGGGACCCTGGGCCTGGCCCAGG + Intergenic
1108956705 13:56167022-56167044 GTGTTTTGTGGGCCAGGCCCTGG - Intergenic
1109962089 13:69644640-69644662 GGGCATCAGGGGCCTGGCCCTGG - Intergenic
1113567244 13:111326422-111326444 GGGCAGCGTGAGCCTGGCGCTGG + Intronic
1113567303 13:111326676-111326698 GGGCAACGTGAGCCTGGCGCTGG + Intronic
1117538058 14:56720493-56720515 GTGCCTCCTGGGGCTGGCACTGG - Intronic
1119805167 14:77477671-77477693 CTGCATCATGTGCCTGGCCATGG - Intronic
1119891932 14:78189420-78189442 GTGTCCCCTGGGCCTGGCCCTGG + Intergenic
1120623239 14:86792006-86792028 CAGCACCCTGGGCCTGGCCCAGG - Intergenic
1121333479 14:93062785-93062807 GTGTATGGTAGGCCAGGCCCTGG - Intronic
1122688183 14:103519794-103519816 GTGCATGGTGGGCACTGCCCAGG + Exonic
1202853557 14_GL000225v1_random:36599-36621 GGGAATCTTGGCCCTGGCCCAGG + Intergenic
1202859609 14_GL000225v1_random:72968-72990 GGGAATCTTGGCCCTGGCCCGGG - Intergenic
1123504724 15:20929461-20929483 GTGCACGGTGTGACTGGCCCTGG + Intergenic
1123561971 15:21503162-21503184 GTGCACGGTGTGACTGGCCCTGG + Intergenic
1123598215 15:21940443-21940465 GTGCACGGTGTGACTGGCCCTGG + Intergenic
1125212046 15:37227932-37227954 TTGCATCGAGGGCCTGGCTGAGG + Intergenic
1129556346 15:76514042-76514064 GTGCATCCTGTGCTTGGCCCTGG - Intronic
1129689714 15:77706274-77706296 GGCCGTGGTGGGCCTGGCCCAGG - Intronic
1130909975 15:88264253-88264275 GTGCATAATGTGCCTAGCCCAGG + Intergenic
1131215335 15:90530681-90530703 GTCCATCCAGGGCCCGGCCCTGG + Intronic
1202970316 15_KI270727v1_random:230288-230310 GTGCACGGTGTGACTGGCCCTGG + Intergenic
1132510779 16:340318-340340 GTGCATCACTGGACTGGCCCGGG + Intronic
1132576658 16:667385-667407 GTGCTGCCTGGTCCTGGCCCTGG + Intronic
1132861291 16:2073024-2073046 GGGATTCGAGGGCCTGGCCCAGG + Intronic
1132862708 16:2079480-2079502 GTGCCACGTGGGCCTGGGCTCGG - Intronic
1133035015 16:3029559-3029581 GTGCGTCGGCGCCCTGGCCCTGG + Exonic
1133256165 16:4517782-4517804 GTGCCTCTTGGGGCTGGTCCTGG + Intronic
1134142083 16:11729180-11729202 GGGCATCAGGGGCCTGGGCCAGG - Intronic
1136024325 16:27460336-27460358 GCTGATCGTGGGCCTGGCACTGG + Intronic
1136024814 16:27462564-27462586 GGGCGTCCTAGGCCTGGCCCAGG + Intronic
1137267423 16:46880680-46880702 GTCCAACGTTGGCCTGGACCAGG - Intergenic
1138540711 16:57685721-57685743 TGGCATGGTGGTCCTGGCCCTGG + Exonic
1138560498 16:57798165-57798187 GTGGAGAGTGGGCCGGGCCCCGG - Exonic
1138604819 16:58081830-58081852 GTCCAGCCTGGGCTTGGCCCGGG + Intergenic
1140472754 16:75224432-75224454 GAGCATGGTGGGGCTGGCCAAGG - Intronic
1140479010 16:75252539-75252561 GTGCCTCCCTGGCCTGGCCCAGG - Intronic
1141374815 16:83520811-83520833 GTGGATCCTGTGCCTGTCCCTGG - Intronic
1142054594 16:87985143-87985165 GTGCTTTGTGGGCCTCGCCAGGG + Intronic
1142188531 16:88706327-88706349 GGGCGGCGCGGGCCTGGCCCCGG - Exonic
1142994680 17:3753680-3753702 GTGCACAGTGGGCCAGGGCCCGG - Intronic
1143016223 17:3892584-3892606 GTGCGGAGTGGGCCCGGCCCGGG - Intronic
1143166370 17:4899173-4899195 GAGCACAGTGGCCCTGGCCCGGG - Intronic
1143893440 17:10119354-10119376 GCTCACCGTGGGCCTGGCCCAGG + Intronic
1144285500 17:13770239-13770261 GAGAACCCTGGGCCTGGCCCAGG + Intergenic
1144891433 17:18496468-18496490 GAGGGTCCTGGGCCTGGCCCAGG + Intergenic
1144891435 17:18496474-18496496 GTGCCTCCTGGGCCAGGCCCAGG - Intergenic
1145140786 17:20447843-20447865 GTGCCTCCTGGGCCAGGCCCAGG + Intergenic
1145140788 17:20447849-20447871 GAGGGTCCTGGGCCTGGCCCAGG - Intergenic
1145274945 17:21423664-21423686 GTGCAGTGTGGGCCTGTCCCTGG + Intergenic
1145312799 17:21709564-21709586 GTGCAGTGTGGGCCTGTCCCTGG + Intergenic
1146241504 17:31232595-31232617 GTGCATGGTGTGAATGGCCCTGG - Intronic
1147625744 17:41898711-41898733 GGCCATTGTGGGCATGGCCCTGG - Exonic
1148062980 17:44849210-44849232 GTGCATTGTGGCTGTGGCCCAGG + Intronic
1149727077 17:58906945-58906967 GTGAATTGTTGGCCAGGCCCAGG + Intronic
1150236018 17:63593234-63593256 GTGAACCCTGGGCCAGGCCCTGG + Exonic
1151698666 17:75731116-75731138 GGGCCACCTGGGCCTGGCCCTGG + Intronic
1151772930 17:76177031-76177053 GTGGATCCTGGGCCTGGGCCTGG - Intronic
1152262279 17:79273614-79273636 GGGCAGCGTGAGGCTGGCCCTGG + Intronic
1152458202 17:80427998-80428020 GGGCATGGGGGGTCTGGCCCTGG - Intronic
1152633315 17:81420354-81420376 GTGCCCAGTGAGCCTGGCCCCGG - Intronic
1152740482 17:82016380-82016402 GTGGAGCTGGGGCCTGGCCCTGG + Intronic
1158222025 18:55160140-55160162 GTGGACCCTGGGCCCGGCCCAGG - Intergenic
1159008723 18:63038515-63038537 GTGCTCTGTGGTCCTGGCCCCGG - Intergenic
1161076322 19:2287517-2287539 GTACATCGTGGTGCTGGCCTGGG + Intronic
1161420781 19:4174987-4175009 GTGCATGGTGGCCCTGGGCAGGG + Intronic
1161801844 19:6420645-6420667 GGGCATTGTGGGCCTTGGCCTGG + Intronic
1162573691 19:11486724-11486746 GGGCCTTGTGGGCCTGGCCCAGG + Intronic
1162700661 19:12512528-12512550 GGGCATCTTGGGTCTGCCCCAGG + Intronic
1162730418 19:12715275-12715297 GTTCATCATGGACCGGGCCCAGG - Exonic
1163399924 19:17086012-17086034 GTGTCTCATGGGCCTGACCCAGG + Intronic
1163635867 19:18437051-18437073 GGGCACCGTGAGCCTGGGCCTGG - Exonic
1165351446 19:35278071-35278093 GTGCTTTGTGGGCCAGGCCCTGG + Intronic
1167079657 19:47270562-47270584 GGGCTTCGGGGGCCGGGCCCAGG - Exonic
1167565961 19:50257303-50257325 GGGCATCGTGGGGCTGGAACAGG + Exonic
1167635060 19:50649479-50649501 GTGCATGGTGGGGCTGCCCATGG - Exonic
925562695 2:5214855-5214877 GTGCATCTTGTTCCTGGTCCGGG + Intergenic
925915375 2:8600693-8600715 GAGAACCGTGGGCCTGGGCCCGG + Intergenic
927095792 2:19746894-19746916 ATGCAGCGTGTGCCTGACCCCGG + Intergenic
929382531 2:41369253-41369275 TGGTTTCGTGGGCCTGGCCCAGG - Intergenic
933773592 2:85758805-85758827 GTGCACAGCTGGCCTGGCCCCGG + Intronic
934663401 2:96154800-96154822 GTTCATCTTGGGCCAGGCACTGG - Intergenic
940790810 2:158027984-158028006 TGGTTTCGTGGGCCTGGCCCAGG - Intronic
946299685 2:218814922-218814944 GTACAAGGTGGTCCTGGCCCCGG + Exonic
947499875 2:230664238-230664260 GTGCATCACAGCCCTGGCCCAGG + Intergenic
948123159 2:235545820-235545842 GTGGATGGTGGTCCTGGGCCTGG - Intronic
1172169210 20:32918710-32918732 GAGCATTGTGGGCCTGGGCAGGG + Intronic
1172177355 20:32980436-32980458 GTGCATTGTGGACCTGGACTGGG + Intergenic
1172222901 20:33285975-33285997 GGGCATCATGGGCCTGCCCTTGG + Intronic
1174277332 20:49413538-49413560 ATACATCAGGGGCCTGGCCCAGG - Intronic
1175217123 20:57397179-57397201 GTGTGTGGAGGGCCTGGCCCTGG + Intronic
1175509571 20:59514790-59514812 GTGCACTCTGGCCCTGGCCCTGG - Intergenic
1175815793 20:61882612-61882634 GAGCATCCTGGGCCTGGCGTCGG - Intronic
1175971552 20:62689160-62689182 GCGCCTCGTAGGCCTGTCCCTGG + Intergenic
1175971569 20:62689224-62689246 GTGCCTCGCAGGCCTGTCCCTGG + Intergenic
1175971589 20:62689292-62689314 GTGCCTCGCAGGCCTGTCCCCGG + Intergenic
1175977257 20:62717190-62717212 GTGCCACGTGGACCTGGCACAGG + Intronic
1176120624 20:63453034-63453056 GTGCAGCGTGGGGCAGGCTCTGG - Intronic
1176205337 20:63885181-63885203 GTCCATGATGGGCCTGTCCCAGG + Intronic
1178367530 21:31999688-31999710 GAGGATCCTGGGCCTGCCCCCGG - Exonic
1178902162 21:36606513-36606535 GCTGAGCGTGGGCCTGGCCCCGG + Intergenic
1179787062 21:43735929-43735951 GTGCATCGTGTACCTGCCCTGGG + Intronic
1180045174 21:45301876-45301898 CTGCCTCCTGGGCCTGACCCTGG - Intergenic
1180083186 21:45496064-45496086 GGGCATGGAGGGCATGGCCCAGG - Intronic
1180109868 21:45642864-45642886 GTTCTCTGTGGGCCTGGCCCCGG - Intergenic
1181334301 22:22117054-22117076 GGGCCTCGTGGGCCAGGCCTCGG + Intergenic
1183156999 22:36083297-36083319 GGGCATCGCAGGTCTGGCCCAGG - Intergenic
1183351438 22:37336853-37336875 GGGCAGGGTGGGGCTGGCCCAGG + Intergenic
1183493058 22:38127000-38127022 GTGGATGGTGGGCCTGATCCCGG - Intronic
1183668886 22:39260535-39260557 GACCATGGTGAGCCTGGCCCAGG + Intergenic
1184588464 22:45463871-45463893 TGGTTTCGTGGGCCTGGCCCAGG - Intergenic
1184676074 22:46044237-46044259 GGGCACCGTGGGCCTGGGCCCGG + Intergenic
1185114703 22:48925653-48925675 GTGCATAGTGAGCGTTGCCCTGG + Intergenic
1185220746 22:49628018-49628040 GTGCATCCTGGGCCCTGCCTGGG - Intronic
950589280 3:13924675-13924697 TGGCTTCATGGGCCTGGCCCAGG + Intergenic
953033720 3:39193711-39193733 GTCCTAGGTGGGCCTGGCCCAGG + Intergenic
953999304 3:47543207-47543229 TTGCATCGTGGCCCTGGGCTTGG - Intergenic
956171870 3:66439198-66439220 GGGCTTCGTGGGCTGGGCCCGGG - Intronic
957662808 3:83183559-83183581 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
959512836 3:107233594-107233616 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
961509859 3:127394155-127394177 GGGCATTATGGGCTTGGCCCTGG - Intergenic
963061764 3:141231916-141231938 GTGCGGCGCGGGCCTGGGCCGGG + Intronic
963908209 3:150791656-150791678 GTGCCTCCTGGCCCTGGGCCTGG - Intergenic
964719407 3:159756456-159756478 GTGGGCCGTGGGCCAGGCCCAGG - Intronic
964897177 3:161612657-161612679 GTGGTTTGTGGGCCAGGCCCAGG + Intergenic
965074905 3:163963885-163963907 GGGCAGCGGGGCCCTGGCCCTGG - Intergenic
965127508 3:164649523-164649545 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
966862551 3:184238691-184238713 GTGGAGCCTGGGCCTGGCTCGGG - Exonic
967155022 3:186684125-186684147 GGGGAACCTGGGCCTGGCCCAGG + Intergenic
968576601 4:1369162-1369184 GTGCCCTGTGGGCCTGGCCTGGG + Intronic
968962026 4:3750524-3750546 GTGTGTCCTGTGCCTGGCCCAGG - Intergenic
969330224 4:6470598-6470620 GTGCCTCGGTGGCCTGGCTCGGG - Intronic
971230970 4:24800034-24800056 CTCCATCGTGGGCCGGGCCGTGG + Exonic
971692397 4:29853904-29853926 GTGCACAATGGGCCTGGTCCAGG + Intergenic
973010722 4:45069599-45069621 GAGCAGCGTGGCCCTGGGCCTGG - Intergenic
973686797 4:53378104-53378126 GCGCATGGTGGGCGTGGGCCAGG - Intronic
977014641 4:91677787-91677809 GGGCACCCTGGGCCTGGCCCAGG - Intergenic
982618931 4:157678685-157678707 GGGCACCCTGGGCTTGGCCCAGG + Intergenic
985084324 4:186297473-186297495 GGGCACCGTGGACCTGGCCCCGG - Intergenic
985756809 5:1724317-1724339 GTGCAGGGTGGGCATGGCCGAGG - Intergenic
985756824 5:1724364-1724386 GTGCAGGGTGGGCATGGCCGAGG - Intergenic
985756839 5:1724411-1724433 GTGCAGGGTGGGCATGGCCGAGG - Intergenic
985825965 5:2191898-2191920 GTGCATCCTGGCCTTGGCTCAGG + Intergenic
987169571 5:15240328-15240350 GTGGGACCTGGGCCTGGCCCAGG - Intergenic
995199996 5:109414943-109414965 AGGCACCCTGGGCCTGGCCCAGG - Intergenic
996033570 5:118733607-118733629 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
997353102 5:133244790-133244812 GTTCAGCCTGGGCCTGGACCTGG - Intronic
997474346 5:134133995-134134017 GGCCATGCTGGGCCTGGCCCAGG - Intronic
1001104286 5:168839912-168839934 GTTCACCCTAGGCCTGGCCCTGG - Intronic
1001231978 5:169996673-169996695 GTGCTTCTTGGGCCTGGACCTGG - Intronic
1001780840 5:174367778-174367800 CTGCATAGAGGGCCTGGCCGTGG + Intergenic
1002103840 5:176870219-176870241 GTGCATCGTGGGCCTGGCCCTGG + Intronic
1005114196 6:22318369-22318391 GTGGATCCTGGGCCTGTCCCCGG + Intergenic
1006738718 6:36292719-36292741 TTGCTTCCAGGGCCTGGCCCAGG + Intronic
1006840130 6:37023105-37023127 GTGCATAGTGGGCATGGGCCTGG - Intronic
1007889266 6:45271337-45271359 GGGGACCCTGGGCCTGGCCCAGG - Intronic
1010713853 6:79206331-79206353 TGGCTTCGTGGGCCTGACCCAGG + Intronic
1012751361 6:103167940-103167962 GAGCAGCGTGGCCCTGGGCCTGG - Intergenic
1013086610 6:106863044-106863066 TGGCTTCGTGGGCCAGGCCCAGG + Intergenic
1013311677 6:108900484-108900506 GTGCACTGTGTGCCAGGCCCTGG - Intronic
1014079577 6:117270981-117271003 GCGCCGCGTGGGCCGGGCCCGGG + Exonic
1014137674 6:117907661-117907683 GTGCATCGTGTGCCGGTTCCGGG - Exonic
1014180394 6:118378015-118378037 GTGCCTTGTGGCCCAGGCCCAGG + Intergenic
1016862803 6:148737556-148737578 GCCCAACGTGTGCCTGGCCCGGG - Intergenic
1016987859 6:149908680-149908702 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
1018902243 6:168057462-168057484 GTGCATGGCCGGCCTGCCCCTGG + Intronic
1019515594 7:1438532-1438554 GTGCAGGGTGGGGCTGGGCCTGG - Intronic
1019532529 7:1510946-1510968 GTGCAGCCTGGGCCTAGACCGGG + Intergenic
1020003437 7:4768621-4768643 GTGCATGGCAGGCCTAGCCCTGG - Exonic
1022412495 7:30149821-30149843 GTTTATCGTGGGCCAGCCCCAGG + Intronic
1022965261 7:35466266-35466288 GTTCATGGCGGGCCTGGCCGGGG - Intergenic
1025170227 7:56749761-56749783 CTGCATCCTGGGCCTCTCCCTGG + Intergenic
1025701656 7:63825945-63825967 CTGCATCCTGGGCCTCTCCCTGG - Intergenic
1026171061 7:67954338-67954360 CTGCATCCTGGGCCTCTCCCTGG - Intergenic
1028011416 7:85648980-85649002 GAGGACCTTGGGCCTGGCCCAGG + Intergenic
1029184971 7:98731836-98731858 CTGGAAGGTGGGCCTGGCCCAGG + Intergenic
1030452586 7:109731316-109731338 GAGGACCCTGGGCCTGGCCCAGG + Intergenic
1031919630 7:127591304-127591326 GGGCATCAGGGGCCTGCCCCTGG - Exonic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1036066897 8:5390641-5390663 GTGCATCTTGGGGCAGGCCTTGG + Intergenic
1036236469 8:7043406-7043428 GTGGACCTTGGGCATGGCCCTGG + Intergenic
1037333060 8:17763607-17763629 GTGCACCGTCGTCCTGGCTCTGG - Intronic
1037979146 8:23238208-23238230 GGGGACCCTGGGCCTGGCCCAGG + Intergenic
1037987902 8:23301089-23301111 GGGGACCGTGGGCCAGGCCCTGG + Intronic
1039270014 8:35869854-35869876 CTGCCTCGGGGGCCTGGCACTGG + Intergenic
1039828538 8:41194941-41194963 ATGGGTGGTGGGCCTGGCCCCGG - Intergenic
1039843219 8:41308388-41308410 GTGCACGGCGGGGCTGGCCCGGG - Intronic
1043818193 8:84829505-84829527 GGGCATAGTGGGCCTGCCTCAGG - Intronic
1048972818 8:139654789-139654811 GTGCATCTTGAGCTAGGCCCCGG - Intronic
1049473925 8:142788211-142788233 TTGCATCTGGTGCCTGGCCCTGG + Intergenic
1051496296 9:17727488-17727510 GGGCATGGAGGGCATGGCCCTGG - Intronic
1053689780 9:40579132-40579154 GTGCATTGTGGGCCTGTCGTGGG - Intergenic
1055856178 9:80691353-80691375 GGGGATCTTGGGCCTGACCCAGG - Intergenic
1059514781 9:114882947-114882969 GTGCTGCCGGGGCCTGGCCCAGG - Intergenic
1059587286 9:115619877-115619899 GGGTTTCGTGGGCCAGGCCCAGG - Intergenic
1060200129 9:121647481-121647503 GTACATCATGGGCCAGGCCAGGG - Intronic
1060358279 9:122931273-122931295 GCGCAGCGTGGGCCGGGCCAAGG + Intronic
1060802133 9:126551476-126551498 GTGCATAGTGGGGCTGGGCGTGG - Intergenic
1061221459 9:129254376-129254398 GTGCACCATGGGTCTTGCCCAGG + Intergenic
1061487999 9:130930001-130930023 GTGCACCGTGCTGCTGGCCCTGG - Exonic
1061517798 9:131099525-131099547 GTGAATCCTGGGCTTAGCCCAGG - Intronic
1061951005 9:133935803-133935825 CTTCAGCGTGGGCCTGGCCTCGG - Intronic
1061980309 9:134099236-134099258 GTGCCTGGTGGGCGTGACCCCGG - Intergenic
1185454131 X:299228-299250 GTGCACCGTGAACCCGGCCCCGG - Exonic
1187623463 X:21085153-21085175 GTGCATCCTGGGCTTGGGGCAGG - Intergenic
1187989179 X:24850925-24850947 GGGCATCACGGCCCTGGCCCAGG - Intronic
1189028865 X:37429071-37429093 GGGGACCCTGGGCCTGGCCCAGG + Intronic
1189450404 X:41123673-41123695 GTCCATCAGGAGCCTGGCCCTGG - Exonic
1191202863 X:57803359-57803381 GTGGTTTGTGGGCCAGGCCCAGG + Intergenic
1192089194 X:68134682-68134704 GTGCTGCCAGGGCCTGGCCCTGG - Intronic
1192631973 X:72784296-72784318 GTGCACCCAGGGCCTGGTCCAGG + Intronic
1192649736 X:72936505-72936527 GTGCACCCAGGGCCTGGTCCAGG - Intronic
1199690877 X:150308308-150308330 GTGCAGAGTGGGGCTGCCCCAGG + Intergenic
1200071526 X:153531636-153531658 CGGCATCCTGGGCCTGGCTCTGG + Intronic