ID: 1002104906

View in Genome Browser
Species Human (GRCh38)
Location 5:176875229-176875251
Sequence CAGGCTAAGGATGGGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002104906_1002104918 21 Left 1002104906 5:176875229-176875251 CCCACTCCCCCATCCTTAGCCTG 0: 1
1: 0
2: 6
3: 32
4: 366
Right 1002104918 5:176875273-176875295 CTGTACACCCAGCTGCCTCCTGG No data
1002104906_1002104914 -10 Left 1002104906 5:176875229-176875251 CCCACTCCCCCATCCTTAGCCTG 0: 1
1: 0
2: 6
3: 32
4: 366
Right 1002104914 5:176875242-176875264 CCTTAGCCTGCAGTTCTCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002104906 Original CRISPR CAGGCTAAGGATGGGGGAGT GGG (reversed) Intronic
900009834 1:96081-96103 CAGGCTAGGGGTAGGGCAGTTGG + Intergenic
900025946 1:272665-272687 CAGGCTAGGGGTAGGGCAGTTGG + Intergenic
900035730 1:406522-406544 CAGGCTAGGGGTAGGGCAGTTGG + Intergenic
900057352 1:642272-642294 CAGGCTAGGGGTAGGGCAGTTGG + Intergenic
900926433 1:5709183-5709205 CAGGCTCAGGTTGGGGCAGGTGG + Intergenic
901102055 1:6726518-6726540 CAGGCTGAGAATGGGGGAGTGGG - Intergenic
902161486 1:14534129-14534151 CAGATTCAGGATGGGAGAGTGGG - Intergenic
902204736 1:14859859-14859881 AAGGATAAGGATGCGGCAGTGGG + Intronic
902987224 1:20162277-20162299 CAGGCTTAGGGTGGGGGATAGGG - Intronic
903002987 1:20279604-20279626 CAGGTTAAGGACAGGGAAGTAGG + Intergenic
903224668 1:21887814-21887836 CAGGCAGAGGATGGGGGCATAGG - Intronic
903328679 1:22585990-22586012 CAGGCCAGGGATGGGGGTGCTGG - Intronic
903650448 1:24918648-24918670 CAGATTAAGGCTGGGGAAGTGGG - Intronic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
903827891 1:26158537-26158559 CAGCCTAAGGGTGGGGGCATTGG - Intergenic
906122632 1:43404516-43404538 CAGTCCAATGATGGAGGAGTAGG - Exonic
906480583 1:46196940-46196962 TAGGCTAAGGATGGGGTAGGGGG - Intronic
906652434 1:47522199-47522221 CAGGCTGAGGATGGGGTGGCAGG - Intergenic
907876940 1:58499221-58499243 CAGGCTGGGGATCGGGGAGTAGG + Intronic
908371868 1:63490503-63490525 CAGGGTATGGTTGGGAGAGTTGG - Intronic
910460203 1:87441028-87441050 CAGACTAAAGATGGGTGAGAAGG - Intergenic
910522303 1:88136626-88136648 AAGGATAAGGAGGGGGGAGTTGG + Intergenic
912333475 1:108841292-108841314 CAGACTAAGGAAGGGAGAGGAGG + Intronic
912723916 1:112042569-112042591 TAGTCCAAGGATGGGGCAGTGGG - Intergenic
913174558 1:116262222-116262244 CAGGCTAAGGAGGTAGGACTTGG + Intergenic
913244534 1:116860067-116860089 CAGGCTCAGGAGGGGTGAGCTGG - Intergenic
913989243 1:143595100-143595122 CAGGCATAGGATGGGTCAGTGGG - Intergenic
914317439 1:146527296-146527318 CAGACTAAAGATGGGTGAGAAGG - Intergenic
914496917 1:148206064-148206086 CAGACTAAAGATGGGTGAGAAGG + Intergenic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915170313 1:153972905-153972927 CAGGAGAAGCATTGGGGAGTTGG + Intronic
915299932 1:154946092-154946114 CAGGCCAAGGGTGGAGGAGTCGG - Exonic
915493912 1:156267582-156267604 CAGGCTGAGGTTGGGTGAGGAGG + Exonic
915561829 1:156692326-156692348 GAGGCTCAGGAAGGGGAAGTGGG + Intergenic
915723303 1:157999713-157999735 CTGGAAAAGGATGGGGGTGTGGG + Intronic
916405770 1:164496716-164496738 CAGGATAAAGATGAAGGAGTGGG - Intergenic
917065561 1:171089414-171089436 CAGGCTCTGGTTGGGGCAGTGGG - Intergenic
917459715 1:175219463-175219485 CAGGATAAAGTAGGGGGAGTTGG - Intergenic
917594597 1:176516358-176516380 AAGGCAGGGGATGGGGGAGTGGG - Intronic
918030858 1:180808784-180808806 CATACTAATGATGGAGGAGTAGG + Intronic
919470936 1:197978452-197978474 GAGGCTGGGGATGGGGGAGAGGG - Intergenic
919753124 1:201050564-201050586 CAGGGTTAGGGTGGGGGAGCTGG + Intronic
919991755 1:202712165-202712187 CTGGCTAAGGGTGGGGGTGGTGG - Intergenic
920573162 1:207033263-207033285 CAGGCTAGGGATGCTGTAGTTGG + Intronic
920702284 1:208226793-208226815 GAGCCTAAGGAAGGGGGAGCAGG - Intronic
920713692 1:208319333-208319355 GTGCCTAAGGAGGGGGGAGTAGG + Intergenic
921068106 1:211637145-211637167 GAGCATAGGGATGGGGGAGTGGG + Intergenic
921674915 1:217966327-217966349 CTGGCTGGGGATGGTGGAGTGGG - Intergenic
921744289 1:218720691-218720713 CAGGCTAAGGATGATGGAACAGG + Intergenic
922533933 1:226365878-226365900 CAGGCCCAGGTTGGAGGAGTGGG + Intronic
923334086 1:232951747-232951769 CAGGCATTGGATGGGGGAGTTGG + Intronic
1062824070 10:556083-556105 CCGGCTATGGAAGGGGGGGTGGG - Intronic
1063964852 10:11338923-11338945 CAGGGTGAGGATGGGGGTGGGGG - Intergenic
1066455454 10:35568180-35568202 CAGGCCGAGGTTGGTGGAGTTGG + Intronic
1067140841 10:43655345-43655367 CATGCTATGGGTGGGGGATTTGG + Intergenic
1068033978 10:51737215-51737237 CAGGGGAAGAATGTGGGAGTGGG - Intronic
1069749675 10:70737188-70737210 CAGCATAGGGGTGGGGGAGTAGG - Intronic
1072409309 10:95185041-95185063 CAGGCTATGGTCGGGGCAGTGGG - Intergenic
1074627502 10:115207832-115207854 CAAGATCGGGATGGGGGAGTGGG - Intronic
1076372971 10:129966906-129966928 CAGGCCAGGGATGGGGAAGGGGG + Intergenic
1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG + Intergenic
1077065090 11:637510-637532 CAGGCTCACGATGAAGGAGTTGG - Exonic
1077284525 11:1759779-1759801 CAGGCTGAGCAGGTGGGAGTGGG - Intronic
1077488897 11:2851460-2851482 CAGGGTGAGGATGGGGAAGCTGG - Intergenic
1077837445 11:5937186-5937208 CAGGCTAGGGATGAGAGAGACGG - Intronic
1078169307 11:8916607-8916629 TAGGAAAAGGATGGGAGAGTGGG + Intronic
1080823248 11:35826738-35826760 CAGGCTAAGAGTGGGGGCTTAGG - Intergenic
1082795570 11:57376206-57376228 ATGGGTAAGGATTGGGGAGTGGG - Intergenic
1083091653 11:60206099-60206121 AAGGAAAAGGATGGGGGAGAAGG + Intronic
1083626201 11:64073324-64073346 CAGGATGGGCATGGGGGAGTGGG - Intronic
1083654662 11:64223673-64223695 CAGGCCAGGGATGGGGGTGGGGG + Exonic
1083775050 11:64890521-64890543 CTGGCAAAGGAGGGGAGAGTAGG + Intergenic
1084189263 11:67491631-67491653 CAGGGTCAGGATGGGGGCCTGGG - Intergenic
1084804804 11:71571488-71571510 CAGGCCAGGGATGGAGGAGCGGG + Intergenic
1084805651 11:71577035-71577057 CAGGCCAGGGATGGAGGAGCGGG - Intergenic
1085268769 11:75256642-75256664 AAAACTAAAGATGGGGGAGTGGG - Intergenic
1089797445 11:120993315-120993337 GAGGGTCAGTATGGGGGAGTGGG - Intergenic
1090741820 11:129669087-129669109 CAGAAAATGGATGGGGGAGTGGG - Intergenic
1091694520 12:2618752-2618774 CAGGAGAAGGAAGGGGAAGTGGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097047801 12:56200449-56200471 CAGGCTAATGATGGGGCAATAGG + Intergenic
1097140189 12:56896066-56896088 CAAGGTAAGGATGGTGGAGGAGG - Intergenic
1097152657 12:56991150-56991172 CAGGTTAAGGCTGAGGGATTTGG - Intergenic
1097307275 12:58083389-58083411 CAGACTAAGGCGGTGGGAGTGGG - Intergenic
1098728457 12:74000045-74000067 AAGGATGAGGATGGGGGAGTTGG + Intergenic
1099301133 12:80895832-80895854 TGTGCTAAGGATGGTGGAGTAGG + Intronic
1100891062 12:99126497-99126519 CAGGGTAAGGTGGGGGGAGGGGG - Intronic
1101306823 12:103536651-103536673 CAGGCTATGGATGTTGGGGTTGG - Intergenic
1101329770 12:103748233-103748255 CATTCTAAGGATGGGAGGGTGGG - Intronic
1101347702 12:103901696-103901718 CAGGCAAAGGGTGTGGGAGTCGG + Intergenic
1101396962 12:104356843-104356865 CAGGCTTAGGGTGAGGGAATAGG - Intergenic
1102086939 12:110149697-110149719 CAGAGTTAGGATGGGGCAGTGGG - Intronic
1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG + Intronic
1102799021 12:115715399-115715421 GAAGCTAAGGAGGGGGGCGTTGG - Intergenic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1104685999 12:130784530-130784552 AAGGCTAAGGTTGGGGGAGTGGG + Intergenic
1105005999 12:132720953-132720975 CAGGCTGAGAAGGGGAGAGTTGG + Exonic
1105349556 13:19602703-19602725 CTGGCTAAAGCTGGGGCAGTAGG - Intergenic
1105699927 13:22927843-22927865 CAGGCTCAGGCTGGGAGAGAGGG + Intergenic
1107043639 13:35973770-35973792 CAGGTTAAGGATGGAGAAGATGG + Intronic
1107437095 13:40389754-40389776 CAGGCTAAGGATGCAGGAACTGG - Intergenic
1108528065 13:51302659-51302681 CACGCTAAGGAAGGAGGAGCTGG + Intergenic
1113681448 13:112247774-112247796 CAGGCGAGGGTTGGGGGGGTGGG - Intergenic
1115309570 14:31965650-31965672 CAGGCTCAGGATGGGGGTAGGGG - Intergenic
1119668045 14:76498834-76498856 CAGGCCACAGATGGGGGAGGGGG - Intronic
1119731164 14:76952091-76952113 GAGGATAAGGATGCTGGAGTCGG - Intergenic
1120034485 14:79681032-79681054 GAGGGTAAGGCTGAGGGAGTTGG - Intronic
1120064182 14:80020342-80020364 CAGGCTCAGGATTAGGGATTGGG - Intergenic
1121249194 14:92487155-92487177 CAGAAGAAGAATGGGGGAGTTGG - Intronic
1123630968 15:22259136-22259158 CGGGCTTAGGATGGGGGCTTGGG - Intergenic
1127361227 15:58246673-58246695 AAGGCTGAGGATGTGGGACTTGG + Intronic
1127762780 15:62155367-62155389 GAGGATAAGGTTGGAGGAGTTGG + Intergenic
1128483584 15:68061941-68061963 CAGGGTAGGGATGGGAGAATGGG - Intronic
1128770553 15:70278548-70278570 CAGGATGGGGATGGGGGAGTGGG + Intergenic
1129084694 15:73076644-73076666 CATGCTGAGGTTGGGGGAGTTGG - Intronic
1129232374 15:74203893-74203915 CAGGCTCAGGATGGGGATGGGGG + Intronic
1130011050 15:80153083-80153105 CAGGTTGTGGATGGGGAAGTCGG - Exonic
1131394097 15:92073042-92073064 CGGGCAAAGGATGGGGGAAAGGG - Intronic
1132132119 15:99292098-99292120 CAGGCCAAGGATGGAGCAGCAGG - Intronic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1132709168 16:1258868-1258890 GAGGCTCAGGATGGAGGAGGGGG - Exonic
1132861303 16:2073082-2073104 CAGGCCAGGGATGAGTGAGTTGG + Intronic
1133734088 16:8600823-8600845 CAGGCCTGGGCTGGGGGAGTGGG - Intergenic
1134541482 16:15070410-15070432 AAGGATAAGGATGGGTGCGTAGG + Intronic
1135120467 16:19761931-19761953 CATGCTAAGGATGGTGAAGCAGG - Intronic
1135359475 16:21799990-21800012 AAGGATAAGGATGGGTGCGTAGG + Intergenic
1135436942 16:22434967-22434989 AAGGATAAGGATGGGTGCGTAGG + Intronic
1137576283 16:49602406-49602428 CAGGCTGAGGGTGGGGGTGAAGG + Intronic
1137725806 16:50655836-50655858 CAGGATAAGGAGGTGAGAGTAGG + Intergenic
1137740686 16:50769803-50769825 GAGGTTAAGGATGGGGCAGGAGG - Intronic
1137830513 16:51539213-51539235 CAGGCACAGGATGGGGGAGAGGG + Intergenic
1138079682 16:54077947-54077969 CATACCAAGGATGGGGCAGTGGG + Intronic
1138550411 16:57744651-57744673 CAGGCTAATGGGGGTGGAGTGGG - Intronic
1139388155 16:66587747-66587769 AAGGCAAAGGCTGAGGGAGTAGG + Intronic
1139860326 16:70015468-70015490 CTAGCTGAGGATGGGAGAGTGGG - Intergenic
1140387993 16:74559454-74559476 GAGGGTAAGGCTGGGGGAGGAGG + Intronic
1140840137 16:78830860-78830882 GAGGGTAAGGATGGGGCTGTAGG - Intronic
1141257987 16:82421418-82421440 CTGATTAAGGATGGGGTAGTGGG + Intergenic
1141710073 16:85693503-85693525 CAGGGGAAGGAAGGGGAAGTGGG - Intronic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1141972059 16:87491370-87491392 CGGGCTTAGGATGGGGGCTTGGG + Intronic
1142157450 16:88539140-88539162 CAGGCAAAGCTGGGGGGAGTGGG - Intergenic
1142454495 16:90210824-90210846 CAGGCTAGGGGTAGGGCAGTTGG - Intergenic
1142598821 17:1043028-1043050 GAGGCTAAGGGTGCAGGAGTGGG + Intronic
1142867553 17:2799880-2799902 CAGGCTGGGGATGGAGGAGCTGG + Intronic
1143497021 17:7318214-7318236 AAGGGTGAGGGTGGGGGAGTAGG + Intronic
1144046838 17:11461645-11461667 CAGGCTTAGGATTGGCTAGTTGG + Intronic
1144398517 17:14870468-14870490 TAGGCTAAGGAGGAGGGAGGGGG + Intergenic
1145312615 17:21708747-21708769 CAGGGGAAGGATAGGGGAGAGGG + Intergenic
1145858276 17:28183614-28183636 CAGGCTAAGGCTGGGTGCGGTGG - Intronic
1146175549 17:30663936-30663958 CAGGAAAGGGATGAGGGAGTAGG + Intergenic
1146348998 17:32079982-32080004 CAGGAAACGGATGAGGGAGTAGG + Intergenic
1146499433 17:33351859-33351881 GGGGATGAGGATGGGGGAGTCGG + Intronic
1148724250 17:49777200-49777222 CAGGGTAGGGGTGGGGGAATAGG + Intronic
1148997645 17:51725227-51725249 CAGGCCAAGGATTGATGAGTGGG + Intronic
1149205919 17:54247739-54247761 CAGGCCATGGATAGGGGTGTGGG + Intergenic
1149772948 17:59335385-59335407 GAGGCAGAAGATGGGGGAGTAGG - Intronic
1150160490 17:62893965-62893987 CAAGGTAGGGATGGGGGAGGCGG + Intergenic
1151354527 17:73550582-73550604 CAGGGTAGGGGTGGGGGAATGGG - Intronic
1151580004 17:74972389-74972411 GAGGCTGAGGGTGGGGGACTAGG + Intronic
1152518257 17:80838691-80838713 GAGGCCAGGGATGGGGGAGGCGG + Intronic
1152524435 17:80879436-80879458 CAGGCCCGGGATGTGGGAGTGGG - Intronic
1152694269 17:81735799-81735821 CAGGAGAAGGAAGGGGAAGTGGG - Intergenic
1153753945 18:8261233-8261255 AAGGCTAAGGATGGGGAGCTGGG + Intronic
1153776929 18:8462721-8462743 CATGTTAAACATGGGGGAGTGGG - Intergenic
1153809277 18:8737674-8737696 CAGGCTAAGGATAGAGCACTGGG + Intronic
1154123460 18:11670087-11670109 CAGGCTGGGGCTGGGGGAGAGGG - Intergenic
1154937666 18:21077525-21077547 GAGGTAAAAGATGGGGGAGTAGG + Intronic
1156315200 18:35963061-35963083 CATGCTAAGGATGTTGGAGCAGG + Intergenic
1156480108 18:37430937-37430959 CAGGCAATGGATGGGAGTGTGGG - Intronic
1157729795 18:49993677-49993699 CAGGCTAAGGCTATGGCAGTAGG - Intronic
1161573842 19:5044750-5044772 CAGGAGAGGGATGGGGGAGAGGG - Intronic
1162340642 19:10089710-10089732 AGGGCTTGGGATGGGGGAGTTGG + Intronic
1162511332 19:11120559-11120581 GAGGCTCAGGAGGGGGCAGTTGG - Intronic
1162805607 19:13136537-13136559 CACCCTAAGGGTGGGGGCGTTGG + Intronic
1162983413 19:14253974-14253996 CAGGAAAGGGATGAGGGAGTAGG - Intergenic
1163398207 19:17076214-17076236 GAGGCCCAGGCTGGGGGAGTGGG + Intronic
1163484082 19:17576295-17576317 CAGCCTAGGGAGGTGGGAGTGGG + Intronic
1164467314 19:28498695-28498717 CAGGGTCAGGATAGGGGAGCAGG + Intergenic
1165070729 19:33253591-33253613 CAGGCTAGGGAGGGGTGGGTGGG - Intergenic
1165261105 19:34618857-34618879 CTGGCTAAGTTTGGGAGAGTTGG - Intronic
1165782627 19:38442891-38442913 CACGCTTGGGATGGGGGAGGTGG - Intronic
1166051522 19:40263590-40263612 CAGGCTCAGGCTGGGGGACTGGG + Intronic
1166361806 19:42255629-42255651 CAGGCTCAGGGTTGGGGGGTTGG - Intergenic
1166373466 19:42314703-42314725 CAGGCTCAGCCTGGGGGAGTGGG + Intronic
1167584485 19:50365892-50365914 CAGCTGAAGGATGGGGGGGTGGG - Intronic
1168080012 19:54003188-54003210 CAGGCTCAGGGAGGGGGAGGCGG + Intronic
1168136609 19:54356186-54356208 CAGGCCTGGGATGGGGAAGTGGG - Intronic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
925710458 2:6734019-6734041 CATGCTAGAGATGGGGTAGTGGG + Intergenic
926033394 2:9613099-9613121 CAGGATAAGGAAGAGGTAGTAGG - Intronic
926438856 2:12865963-12865985 CCAGCTAAGGAAGGGGGATTAGG - Intergenic
927055747 2:19364140-19364162 CAAGCTCAGGATAGGGAAGTGGG - Intergenic
927199787 2:20571203-20571225 CAGCCTAAGGAAGGGGGTGCTGG - Intronic
927256296 2:21043693-21043715 CAGGCTCAGGATGGGGGGCGCGG - Intronic
927372675 2:22375246-22375268 CAGGTGAAGAATGGGGGAGATGG - Intergenic
927909877 2:26889780-26889802 CAGGCAGAGGGTGGGTGAGTGGG - Intronic
928246919 2:29638495-29638517 CAGGGCAAGGATGATGGAGTAGG + Intronic
929829968 2:45339292-45339314 GAGGACAGGGATGGGGGAGTTGG - Intergenic
931938918 2:67230699-67230721 CAGGCACAGGATGGGGGATGGGG - Intergenic
931948121 2:67332872-67332894 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
933559734 2:83875138-83875160 CAGGCTAGGGATGAGAGAGATGG + Intergenic
935725211 2:106018122-106018144 CAGGGCAAGGAGTGGGGAGTGGG + Intergenic
936284717 2:111173245-111173267 CAGAGTGAGGATGGGGCAGTGGG - Intergenic
936324114 2:111490251-111490273 AGTGCTAAGGATGGCGGAGTAGG + Intergenic
937073585 2:119084259-119084281 CAGACTAAGGAGGTGGCAGTGGG - Intergenic
937463626 2:122110478-122110500 CAGGAAAAGGATAGGGGAGCTGG + Intergenic
941045598 2:160671803-160671825 CAAGCTCAGGATGGGAGCGTGGG - Intergenic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
942617488 2:177809097-177809119 CAGGCTGAAGAGAGGGGAGTGGG + Intronic
944880602 2:204009022-204009044 AAGCCTTAGGATGGAGGAGTAGG - Intergenic
945056931 2:205877583-205877605 AAGGCTGAGCATGGGGGAGAAGG - Intergenic
946309019 2:218872576-218872598 CAGACTCAGGAGGTGGGAGTGGG + Intronic
946383838 2:219369351-219369373 CAGGCCAAGGTGGGGGGAATTGG + Intergenic
946685378 2:222264379-222264401 CAGGAGACGGATGGGGGATTGGG + Intronic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
948877502 2:240837501-240837523 CAGGCTGAGGAGGTAGGAGTAGG - Intergenic
948976295 2:241465766-241465788 CAGGCGAGGGATGGAGGAGGGGG - Intronic
949085954 2:242155478-242155500 CAGGCTAGGGGTAGGGCAGTTGG - Intergenic
1169163901 20:3406847-3406869 CAGGCTGAGGCAGGGGGAGCTGG + Intronic
1169456647 20:5758242-5758264 CAAGCTAAGGTGGGGGGATTTGG + Intronic
1169507237 20:6224643-6224665 CAGGATAAGGGTAGGGGCGTTGG - Intergenic
1171343165 20:24446182-24446204 AAGACCAAGGCTGGGGGAGTGGG - Intergenic
1172812874 20:37662476-37662498 CTGCCTAAGGCTGGGGGAGGTGG - Intergenic
1172842720 20:37911711-37911733 CAGGCACAGGGTGGGGGAGAGGG - Intronic
1173200784 20:40953640-40953662 CAAGCTAAGGATGAGGAAGTTGG + Intergenic
1173981879 20:47230809-47230831 AAGACTAAGGCCGGGGGAGTGGG - Intronic
1174406629 20:50307038-50307060 CAGGCTCAGGAGCTGGGAGTGGG + Intergenic
1175371514 20:58495946-58495968 CAGGCCAAGGATGGGGGATGTGG - Intronic
1175829290 20:61953340-61953362 CAGGGGGAGGATGAGGGAGTGGG - Intergenic
1175938288 20:62525262-62525284 CAGGCCATGGCGGGGGGAGTGGG + Intergenic
1179335432 21:40447169-40447191 CAGGCTAAGGTTGGGCATGTAGG + Intronic
1179790297 21:43752433-43752455 CAGGTGATGGATCGGGGAGTGGG + Intronic
1180091227 21:45534707-45534729 AAGGCTGAGGAAGAGGGAGTAGG - Intronic
1180994787 22:19959998-19960020 CAGGCAAAGGAAGGGGGCTTCGG + Intronic
1181582770 22:23837222-23837244 CAGGCTGTGGATGGGGGCCTGGG - Intronic
1182822856 22:33233613-33233635 CAGACAAGGGATGGGGGAGAGGG + Intronic
1183952558 22:41359715-41359737 CAGGGTAAGGAAGAGAGAGTGGG + Exonic
1184019803 22:41813423-41813445 CAGGCTGAGGATGGGCGAGTGGG - Exonic
1184288524 22:43485982-43486004 CAGGCAAAGGCTGGGGGAGATGG - Intronic
1184553480 22:45218691-45218713 CAGGCTAAGGATAAGGATGTGGG - Intronic
1184562420 22:45270846-45270868 GTGGCTAAGGATGGGGGCATCGG + Intergenic
1185337355 22:50276565-50276587 CAGGCTCAGCATGGGGTAGTGGG + Intronic
1185377044 22:50487490-50487512 CAGGGTGTGGATGGGGGAGAAGG - Intronic
949510813 3:4765177-4765199 AAGGCTAAGCATAGGGGAGGTGG + Intronic
949546799 3:5079893-5079915 CGGACAATGGATGGGGGAGTGGG - Intergenic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
950449519 3:13057835-13057857 CAGGCATGGGGTGGGGGAGTGGG - Intronic
952580206 3:34824298-34824320 GAGGCCCAGGATGGGGGTGTGGG - Intergenic
953410495 3:42688087-42688109 TGGGCTGAGGCTGGGGGAGTGGG + Intronic
953853829 3:46485537-46485559 CAGGCTAAGGCTGGGGGCAGGGG + Intergenic
954290080 3:49645088-49645110 CTGGCTAAGGAGGGGGCAGTGGG - Intronic
954596447 3:51829575-51829597 CAGGCAAAGAATGGGGAACTGGG + Intronic
954752016 3:52819137-52819159 GACGCTAAGGATGGGGCAGGGGG + Exonic
954807519 3:53229175-53229197 CAGCCCATGGATGGGGGGGTAGG - Intronic
955010152 3:55006104-55006126 CATGCTAAGGTTAGGGGAGTTGG - Intronic
955773385 3:62408222-62408244 CAGGATTAGGGTGAGGGAGTAGG + Intronic
956686043 3:71828423-71828445 GGGGCTGGGGATGGGGGAGTGGG + Intergenic
957615408 3:82519877-82519899 CAGGCTAAGTATAGTGGAGAAGG - Intergenic
958973440 3:100638484-100638506 TAGGCACAGGATGGGGGAGTAGG + Intronic
959612836 3:108314360-108314382 CAGCCTAAGGATGTAGGAGTAGG - Intronic
960176494 3:114523783-114523805 GAGCGTAAGGATGGGGGAGGAGG + Intronic
961390670 3:126550712-126550734 CATGCCAGGGCTGGGGGAGTGGG - Intronic
961446038 3:126982337-126982359 CAGGCCAAGGAAGGGGAAGCCGG - Intergenic
961654077 3:128432148-128432170 CAGGCCAGAGATGGGGGAGGTGG + Intergenic
962306868 3:134295339-134295361 CAGGTTAAGGATGAGGGATAAGG + Intergenic
962378204 3:134876141-134876163 AAGGATAAGGCTGGGGAAGTGGG - Intronic
962486044 3:135843336-135843358 GAGGCTAGGGGTGGGGGAATTGG + Intergenic
963346888 3:144105563-144105585 CAGGCTGGGGAGGTGGGAGTGGG + Intergenic
963770622 3:149382717-149382739 CAGGCTGAGGGTGGGGTGGTGGG - Intergenic
966849565 3:184156125-184156147 CAGGAGGAGGATGGGGGACTCGG - Intronic
968654891 4:1774157-1774179 CATGGGAAGGATGGGGGTGTTGG + Intergenic
968964043 4:3760506-3760528 CAGGCCCAGGATGGTGGAGCAGG + Intergenic
969686301 4:8676266-8676288 GAGGCCAAGGCTTGGGGAGTAGG - Intergenic
970452025 4:16178587-16178609 CAGGCTAATTAAGGGGAAGTGGG - Intronic
970661576 4:18291585-18291607 CAGGCTTAGAATGGCAGAGTGGG + Intergenic
971730252 4:30370180-30370202 CGGGCACAGGATAGGGGAGTGGG - Intergenic
973547979 4:52001327-52001349 CAGGCAAAGGATGAGCAAGTGGG + Intronic
974303247 4:60097908-60097930 TAGGCACAGGATGGGGGCGTGGG - Intergenic
974752022 4:66154109-66154131 TAGGCCCAGGATGGGGGTGTGGG - Intergenic
974754817 4:66189498-66189520 AAGGGTAAGAATGGGTGAGTTGG - Intergenic
975281659 4:72569034-72569056 CAGGCTAAGCCTGGGAGAGGGGG + Intergenic
975827185 4:78332060-78332082 CAGGCTTAGGATTGGCTAGTTGG + Intronic
977933993 4:102780073-102780095 GAGGCCAAGGCTGGAGGAGTAGG + Intergenic
979213548 4:118135255-118135277 CAGGCTTAGGAAGGGGTAGTGGG + Intronic
982118337 4:152116187-152116209 CCGGCTGAGGATGAGGGACTGGG - Intergenic
986006266 5:3671699-3671721 CAGGGTTAGGAGGTGGGAGTCGG - Intergenic
989000656 5:36756940-36756962 CAGTGTAAGGAAGGGGAAGTTGG + Intergenic
989002923 5:36779929-36779951 CAGGTTGAGGATGGGGATGTGGG - Intergenic
989439912 5:41458118-41458140 CAGGCGTGGGATGAGGGAGTAGG - Intronic
990043148 5:51396433-51396455 GAGGCTACGGCTGGGGAAGTGGG - Intergenic
991319077 5:65348491-65348513 CAGGCTAGGGATGGGAGAGAAGG + Intronic
991631179 5:68657640-68657662 CAGGATTTGGATGGGAGAGTTGG - Intergenic
991929092 5:71733978-71734000 TTGCCTAAGGCTGGGGGAGTGGG - Intergenic
992074363 5:73177178-73177200 CAGGCTGAGGATGGAGGAGAGGG - Intergenic
992570800 5:78054957-78054979 CAGGGAAAGGATGGGGAAATGGG + Intronic
992821663 5:80503952-80503974 CAGGCTATGGATGGAAGACTAGG + Intronic
994775546 5:104032901-104032923 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
995455428 5:112346934-112346956 CAGGAGAAGGATCTGGGAGTAGG + Intronic
995884227 5:116875822-116875844 CATCCTAAGGAAGGGTGAGTAGG + Intergenic
996355156 5:122587472-122587494 CAGGATAAGGATGGGGAAATTGG + Intergenic
996650355 5:125868466-125868488 CAGGCCATAGTTGGGGGAGTGGG - Intergenic
997610547 5:135212864-135212886 CAGGCTGAGGCTGGGGGATGGGG - Intronic
997837206 5:137204933-137204955 CAAGCAAAGGGTGGTGGAGTTGG - Intronic
998378673 5:141708526-141708548 CGGGCCAAGCATGGGGGTGTCGG + Intergenic
998621019 5:143794247-143794269 CAGGCTTGGCCTGGGGGAGTTGG + Intergenic
999360027 5:150976327-150976349 AAGGCTAAGTTTGGGGGAGATGG - Intergenic
1000045985 5:157522446-157522468 CAGGGTAAGGTTGTGGGACTTGG - Intronic
1000752481 5:165113951-165113973 TAGGCTGAGGATGGGGAAGAAGG - Intergenic
1001383671 5:171320360-171320382 TAGGCTAAGGAGGAGGAAGTGGG - Intergenic
1002104906 5:176875229-176875251 CAGGCTAAGGATGGGGGAGTGGG - Intronic
1002738091 5:181412342-181412364 CAGGCTAGGGGTAGGGCAGTTGG - Intergenic
1003199601 6:3946951-3946973 GCGGCTAAGGATGGGGGCGCTGG + Intergenic
1003263485 6:4546463-4546485 CAGGCTCAGGATGGGGTTCTGGG - Intergenic
1003425587 6:5996356-5996378 CAGGCTAAGGGCGGGGCAGAAGG - Intergenic
1004489126 6:16097378-16097400 CAAGCTAAGGCTGGGGCAGTGGG + Intergenic
1005871018 6:29974633-29974655 GAGGCTGAGGATGAAGGAGTGGG + Intergenic
1006058904 6:31404822-31404844 GAGGCTGAGGATGAAGGAGTGGG - Intronic
1006071388 6:31499707-31499729 GAGGCTGAGGATGAAGGAGTGGG - Intronic
1006432687 6:34007619-34007641 CAGGCTAAGGATGGCAGTGATGG + Intergenic
1007619646 6:43204170-43204192 CAGGGTGGGGATGGGGTAGTGGG - Intronic
1007761005 6:44133745-44133767 CTGGCAAAGGAGGGGGGAGTGGG - Intronic
1007767486 6:44169622-44169644 CAGGGTCAGAATGGGGTAGTGGG - Intronic
1010539414 6:77072601-77072623 CAGAAAAAGGATGGGGGAATGGG + Intergenic
1010556189 6:77282155-77282177 CAGGCACAGGATGGGGGAGCAGG + Intergenic
1010609275 6:77933242-77933264 CTGGCTAAGGATAGTGGATTTGG + Intergenic
1011574075 6:88775388-88775410 AGTGCTGAGGATGGGGGAGTTGG - Intronic
1012290284 6:97447163-97447185 CAGGAGAAGGATGAGGGAGTAGG - Intergenic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1016833921 6:148458154-148458176 CATACTAAGGATGGTAGAGTAGG - Intronic
1016897690 6:149069610-149069632 TATGGTTAGGATGGGGGAGTTGG - Intronic
1017778583 6:157698816-157698838 CAGGCAAAGGCTTGGGAAGTGGG + Intergenic
1018582011 6:165315768-165315790 TTGGCTAGGGATGGGGGAGATGG + Intergenic
1019136518 6:169911934-169911956 CAGGCTCAGGATGGGGGTGTAGG - Intergenic
1019243192 6:170687901-170687923 CAGGCTAGGGGTAGGGCAGTTGG - Intergenic
1019518156 7:1448562-1448584 CAGGCCAAGGATGGGGGGCCTGG + Intronic
1020274694 7:6616987-6617009 GAGGCTCAGGACTGGGGAGTTGG - Intronic
1020878629 7:13730077-13730099 GAGGCGAAGGATGGGGGCGGTGG + Intergenic
1021056448 7:16053288-16053310 CGGGATGAGGATGGGGAAGTAGG - Intergenic
1021585110 7:22199396-22199418 CAGGTTAAGGCTGGTGGAGATGG + Intronic
1022045824 7:26621445-26621467 CAAGCCAGGGTTGGGGGAGTGGG + Intergenic
1023117442 7:36876040-36876062 CAGGTTAAGAATGGGGCTGTGGG + Intronic
1023222555 7:37934274-37934296 CATGCTAAGAATGGCAGAGTAGG - Intronic
1026978716 7:74514345-74514367 CAGGGCCAGGATGGGGGACTGGG + Intronic
1028401039 7:90425710-90425732 CAGGCTAGGGATGGGGGAGAGGG + Intronic
1028405039 7:90465539-90465561 AAGGGCAAGGATGGAGGAGTAGG - Intronic
1029040213 7:97565402-97565424 CAGGCTACGTAAGGGGAAGTTGG - Intergenic
1029440681 7:100585225-100585247 CAGGCTTAGGAAGGAGGAGGAGG + Intronic
1030715186 7:112801004-112801026 CAGGCTTATGATGGAGGAGAGGG + Intergenic
1030894220 7:115037599-115037621 AAGGCTAAGGCTAGGGCAGTGGG + Intergenic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1034282527 7:149864113-149864135 CAGGCTCAGGAAGGAGGAGATGG + Exonic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034562497 7:151890048-151890070 CAGGCTGTGGTTGGGGGATTTGG + Intergenic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1035034438 7:155885864-155885886 AAGGAAAAGGATGGGGGAGGAGG - Intergenic
1035504930 8:120262-120284 CAGGCTAGGGGTAGGGCAGTTGG + Intergenic
1036293673 8:7517872-7517894 CGGTCTCAGGATGGGGTAGTGGG - Intergenic
1036307293 8:7611528-7611550 CAGTCCCAGGATGGGGGAGGAGG + Intergenic
1036328888 8:7803123-7803145 CGGTCTCAGGATGGGGTAGTGGG + Intergenic
1036892814 8:12607431-12607453 CAGTCCCAGGATGGGGGAGGAGG - Intergenic
1038099858 8:24361268-24361290 CAGGATTAGGCTGGAGGAGTTGG + Intergenic
1038675202 8:29616676-29616698 CTGGGTAAGGAAGTGGGAGTGGG + Intergenic
1039059095 8:33559420-33559442 CTAGCTAGGGATGGGGGAGTTGG - Intronic
1039349035 8:36741008-36741030 CAGGCTAAAGATGGTGAAATAGG - Intergenic
1040555621 8:48475189-48475211 CAGGATATGAATGGGGCAGTAGG - Intergenic
1041099524 8:54382050-54382072 CGGGCTAAGGCTGGGGGTGGGGG + Intergenic
1041327431 8:56683235-56683257 CAAGCCCAGGATGGGGGACTTGG - Intergenic
1042453408 8:68974446-68974468 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
1042721283 8:71829336-71829358 CAGGTTAAGGCAGAGGGAGTGGG + Intronic
1046708139 8:117478476-117478498 AAGGAGAAGGATGGGGCAGTGGG + Intergenic
1048337683 8:133515061-133515083 CTGGCAGAGGGTGGGGGAGTTGG - Intronic
1048500436 8:134970248-134970270 CATGGAAAGGAGGGGGGAGTAGG + Intergenic
1049002204 8:139833283-139833305 AAAGCTAAGGAAGGGGAAGTCGG - Intronic
1049320235 8:141992327-141992349 TAGGCTAACGAGGGGGCAGTGGG - Intergenic
1049511382 8:143028430-143028452 GAGGCTGTGGATGGGGGAGGTGG - Intergenic
1050619465 9:7437411-7437433 CAGTGAAAGGATGAGGGAGTTGG + Intergenic
1051871671 9:21745165-21745187 CAAGCTAAGGATGAGACAGTAGG + Intergenic
1052892163 9:33711780-33711802 CAGAAAATGGATGGGGGAGTGGG - Intergenic
1053266103 9:36714579-36714601 CAGGCTCAGGGTGGGGGAAGTGG + Intergenic
1054809893 9:69426354-69426376 CAGTCTGGGGATGGGGAAGTAGG + Intergenic
1054908508 9:70431862-70431884 AAGGGTAAGGGTGGGGGAGGAGG - Intergenic
1056739233 9:89238640-89238662 CTGCCTAGGGATGGGGGAGGTGG + Intergenic
1058543348 9:106035186-106035208 CAGTCTAAGCATGGCTGAGTTGG + Intergenic
1060207421 9:121690422-121690444 CTGGCTAAGGGGTGGGGAGTTGG - Intronic
1060453384 9:123765218-123765240 CAGGGAAAGTATGGTGGAGTTGG + Intronic
1060767589 9:126306697-126306719 CAGGCTGAGGAAGGGGCTGTGGG + Intergenic
1061220338 9:129246878-129246900 CAGCCGAAGGATGGGGGAGATGG + Intergenic
1062280753 9:135750648-135750670 CAGGATAGGGATTGGGGAGCAGG - Intronic
1203603381 Un_KI270748v1:37125-37147 CAGGCTAGGGGTAGGGCAGTTGG - Intergenic
1186451431 X:9677090-9677112 GAGGCCAAGGATGAGGAAGTGGG - Intronic
1186498616 X:10032496-10032518 CAGGCCAAGGAGGAGGCAGTGGG + Intronic
1186799499 X:13078923-13078945 CAGGATCAGGACGGGGCAGTGGG - Intergenic
1187845770 X:23535364-23535386 CATGCTAAAGATGGAAGAGTAGG + Intergenic
1188090897 X:25964319-25964341 CAGGGGAAGGATGGGGGACAAGG + Intergenic
1190026752 X:46930889-46930911 CAGGGTATGGATGGGGGGCTGGG - Intronic
1190048084 X:47128610-47128632 CAGTCTTAGGGTTGGGGAGTTGG - Intergenic
1191778471 X:64843706-64843728 CAGGTTTAGAATGGGTGAGTAGG - Intergenic
1191850084 X:65579826-65579848 CAGGTAAAGGATGGGAGAGATGG - Intergenic
1198594246 X:138218879-138218901 CAAGTTAGGGATGGGGGACTGGG + Intergenic
1198613237 X:138425309-138425331 TGGGCACAGGATGGGGGAGTGGG - Intergenic
1199651734 X:149951790-149951812 CATGATGAGGAAGGGGGAGTCGG - Intergenic
1199698789 X:150362019-150362041 CGCGCTAAGGGTGGGGGACTGGG + Intronic
1201770586 Y:17613894-17613916 CAGGCTAGGGATGAGAGAGATGG - Intergenic
1201830969 Y:18292092-18292114 CAGGCTAGGGATGAGAGAGATGG + Intergenic