ID: 1002105490

View in Genome Browser
Species Human (GRCh38)
Location 5:176877671-176877693
Sequence CTCAAAAAGCAGTCGTGCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 46}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002105481_1002105490 17 Left 1002105481 5:176877631-176877653 CCACTGTGGGGAGCCCAGCCCTG 0: 1
1: 2
2: 8
3: 90
4: 518
Right 1002105490 5:176877671-176877693 CTCAAAAAGCAGTCGTGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 46
1002105479_1002105490 29 Left 1002105479 5:176877619-176877641 CCTGGCTATGGACCACTGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1002105490 5:176877671-176877693 CTCAAAAAGCAGTCGTGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 46
1002105486_1002105490 -2 Left 1002105486 5:176877650-176877672 CCTGACAGCTGGAGCCTGCGCCT 0: 1
1: 0
2: 1
3: 19
4: 185
Right 1002105490 5:176877671-176877693 CTCAAAAAGCAGTCGTGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 46
1002105484_1002105490 3 Left 1002105484 5:176877645-176877667 CCAGCCCTGACAGCTGGAGCCTG 0: 1
1: 0
2: 3
3: 51
4: 503
Right 1002105490 5:176877671-176877693 CTCAAAAAGCAGTCGTGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 46
1002105485_1002105490 -1 Left 1002105485 5:176877649-176877671 CCCTGACAGCTGGAGCCTGCGCC 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1002105490 5:176877671-176877693 CTCAAAAAGCAGTCGTGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 46
1002105483_1002105490 4 Left 1002105483 5:176877644-176877666 CCCAGCCCTGACAGCTGGAGCCT 0: 1
1: 0
2: 4
3: 36
4: 383
Right 1002105490 5:176877671-176877693 CTCAAAAAGCAGTCGTGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002105490 Original CRISPR CTCAAAAAGCAGTCGTGCGA GGG Exonic
913332430 1:117678617-117678639 CTCAAGAAGAAGTGGTGCCAGGG - Intergenic
920839284 1:209540504-209540526 CTCAAAAATCAGTCTTTTGAAGG - Intergenic
1063556264 10:7082357-7082379 CTTAAAAAGCATTCGTGGGCTGG - Intergenic
1070068176 10:73058823-73058845 CTAAAAATGCAGTGGTGCGATGG + Intronic
1074662831 10:115681807-115681829 CTCAAAAAGAAGTGGTGGGTGGG - Intronic
1080784735 11:35464420-35464442 CTCAAAGATCAGTAGTGCCAAGG - Intronic
1081423325 11:42898070-42898092 CACCAAAAGCAGTAGTGGGATGG - Intergenic
1083860095 11:65415762-65415784 CTGAAAAAACAGTGGTGCAAGGG + Intergenic
1086573822 11:88315213-88315235 CTCAAACAGCAGAGGTGGGAGGG - Intronic
1086783731 11:90938823-90938845 CTCAAAAAGCAGGAGAGTGAAGG + Intergenic
1089720218 11:120411238-120411260 CTCAAAAAGCACTCATCGGAGGG + Intronic
1090082431 11:123622958-123622980 CTCAAAAAGAAGTCTTAAGACGG + Intronic
1097892690 12:64793783-64793805 CTCAATCAACAGTCGTGTGAGGG - Intronic
1098870884 12:75815642-75815664 TTCAAAAAGCAGGCTTGCTAGGG + Intergenic
1105520701 13:21128384-21128406 ATTAAAAAGCAGTAGTGAGAAGG + Intergenic
1106103280 13:26712716-26712738 ATTAAAAAGCAGTGGTGAGAGGG + Intergenic
1118523994 14:66620200-66620222 CTCAAAAGGCAGTATTGCTATGG + Intronic
1120580097 14:86236510-86236532 CTGAAAAAGTAGTGGGGCGAGGG + Intergenic
1126031383 15:44502521-44502543 CACAAAAAGCAGTCATGACAGGG - Intronic
1137328035 16:47461204-47461226 CTAAAAAAGCAGTGGAGCTAGGG + Exonic
1143126712 17:4646164-4646186 CTCAAAACTCAGTGGTGTGATGG - Intergenic
1143403933 17:6664224-6664246 GGCAAAAAGCAGACGTGGGATGG - Intergenic
1147050759 17:37792942-37792964 CTCAGAGAGCAGTCCTGCAAAGG + Intergenic
1165588961 19:36948813-36948835 GTTAAAAAGCAGTAATGCGAGGG + Intronic
931639235 2:64367190-64367212 CTCACAAAGCAGCCATGTGAAGG - Intergenic
932843037 2:75102044-75102066 CTCAAAAAGCATTAGTGCCATGG + Intronic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
1168811587 20:708199-708221 CTCAGAAAGTAGTGGTGCCAGGG - Intergenic
1179151633 21:38814004-38814026 GTCACAAAGCAGTTGTGCGTAGG - Intronic
1180122990 21:45766310-45766332 CTCCAAAAGCAGTCATACTAGGG - Intronic
949365434 3:3275433-3275455 CTCCAAATGCAGTAGTGCTAAGG - Intergenic
950422766 3:12908447-12908469 CTCAAAAAGGAGTCGGGCAACGG - Exonic
954348343 3:50020512-50020534 CACAAAAAGCAGTGCTGAGAGGG - Intronic
962374594 3:134849739-134849761 CTCAAGAGGCAGCCATGCGAGGG - Intronic
964853896 3:161124257-161124279 GTTAAAAAGCAGTGGTGAGAGGG - Intronic
968209322 3:196834834-196834856 CTCAAAAAGCTGTAGTGCAATGG - Intergenic
968542707 4:1175951-1175973 CTCCAAAAGCACGCCTGCGAAGG + Intronic
976618440 4:87102069-87102091 CTGAAAAAGCAGTTGTACAAAGG + Intronic
986560359 5:9054426-9054448 CTCCAAATGCAGCCCTGCGAGGG - Intronic
1002105490 5:176877671-176877693 CTCAAAAAGCAGTCGTGCGAGGG + Exonic
1009299394 6:61995591-61995613 CTCAAAAGGCAGGCATGCAAGGG + Intronic
1013343226 6:109235917-109235939 CCCAAAAATCAATCGTGCCAAGG - Intergenic
1016256086 6:142107272-142107294 CTCAAAAACCAGTCTTGCAAAGG + Intergenic
1029729709 7:102431442-102431464 CTCAAAAAGCAATCATGTTATGG - Intergenic
1033711053 7:143945277-143945299 GTTAAAAAGCAGTGGTGAGAGGG + Intergenic
1041426473 8:57726434-57726456 CTCAAAAAGTTGTTGTGGGAAGG + Intergenic
1041988530 8:63955908-63955930 CTCAAAAAGCAGTAGAGGGATGG - Intergenic
1058072124 9:100612007-100612029 CTCAAAAAGCAGGCTTGAAAGGG - Intergenic
1186260865 X:7777904-7777926 CTCAAATATCAGTAGTGCAAAGG - Intergenic
1187992606 X:24891538-24891560 TTCAAAAAACAGTTGTGCAATGG + Intronic
1193448190 X:81631975-81631997 TTGAAAAAGCAGTTGTGAGAGGG + Intergenic
1198806257 X:140498409-140498431 CTCTAAAAGAAGTGGTGCTAGGG + Intergenic