ID: 1002106280

View in Genome Browser
Species Human (GRCh38)
Location 5:176880830-176880852
Sequence CCCCTATGTGCCCCGGCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002106280 Original CRISPR CCCCTATGTGCCCCGGCGGC CGG (reversed) Exonic
904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG + Intergenic
907261282 1:53220533-53220555 CCCCTCCGTGTCCCCGCGGCGGG + Intronic
907312042 1:53544360-53544382 CCTCACTGTGCCCCGGGGGCCGG - Intronic
915366692 1:155320914-155320936 CCGCTCTGTGCCCCGCCGGGCGG + Exonic
915519792 1:156435534-156435556 CCTCTGTGTGCCCCGGGGCCAGG + Intergenic
1066126321 10:32346576-32346598 CCCCGCTGGGCCGCGGCGGCCGG + Intronic
1073143017 10:101261374-101261396 CCCCTCTGAGCCCCGGGGGAGGG - Intergenic
1074944718 10:118270298-118270320 CCCCTAGCTGCCCTGGCTGCTGG - Intergenic
1077077552 11:708355-708377 CACCTGTCTGCCCTGGCGGCTGG + Intronic
1079251713 11:18791922-18791944 CCCCTTCGTGCCCCGGGAGCAGG - Intronic
1085765806 11:79280588-79280610 CTCCTATGTGTCCCGGGGCCAGG - Intronic
1088458483 11:110058303-110058325 CCCCTAAGTGCCCCTGTAGCAGG + Intergenic
1089118812 11:116117671-116117693 CCCCTAAGTGCCCCTGCCACTGG + Intergenic
1089733463 11:120534084-120534106 CCCCTCTGTACCCCGGTGCCTGG - Intronic
1095891229 12:47236237-47236259 CCCCTATGTACCACTGGGGCAGG - Exonic
1096510836 12:52127275-52127297 TCCCTTTCTGCCCCGGCTGCTGG - Intergenic
1097918206 12:65042130-65042152 CCCCTAGGTGTCCAGGCTGCAGG + Intergenic
1103729503 12:123017849-123017871 CCCCCATGTTCCCCAGCAGCAGG - Intronic
1104586487 12:130052128-130052150 CTGCTGTGTGCCCTGGCGGCAGG - Intergenic
1105407705 13:20145568-20145590 CCCCTACCTGCCCAGGCGTCTGG + Intronic
1109741526 13:66561172-66561194 CCCCTCACTGCCCCGGTGGCGGG - Intronic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1123393221 15:19899168-19899190 CCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1128309758 15:66622521-66622543 CCCCTAGATGCCCCCGCGCCAGG + Intronic
1131094931 15:89648935-89648957 CTCCTATGTGGCCTGGGGGCCGG - Intronic
1132348698 15:101123835-101123857 CCTCCATGTGCCCCTCCGGCAGG - Intergenic
1132463025 16:64739-64761 CCACCATGAGCTCCGGCGGCCGG - Exonic
1132742266 16:1420692-1420714 GTCTTGTGTGCCCCGGCGGCCGG - Exonic
1136621150 16:31429252-31429274 CCCCTAGGTCCCCCAGCTGCAGG + Intergenic
1138153203 16:54678505-54678527 CCCCTGTGTGCCCCTGGGACTGG - Intergenic
1138676160 16:58653038-58653060 CCCAGATGTTCCCCGGGGGCAGG + Intergenic
1139649784 16:68356467-68356489 CCCATGTGTGGCCCGGCTGCAGG + Intronic
1139967921 16:70755879-70755901 CCCCTAGGTTCCCAGGTGGCTGG - Intronic
1141695000 16:85614930-85614952 CCCCTTTGTCCCCCGCCGCCTGG - Intronic
1143033647 17:3982226-3982248 ACCCCAGGTGCCCCGGCCGCGGG + Intergenic
1145694523 17:26775729-26775751 GCCCTCAGTGCCGCGGCGGCGGG - Intergenic
1147179229 17:38674250-38674272 CCCCCCTGCGCCCTGGCGGCTGG - Exonic
1148235831 17:45968396-45968418 CCCCTGTCTGCCCAGGAGGCTGG + Intronic
1152111154 17:78358450-78358472 CCCGAATGGGCCCCGGCAGCTGG + Exonic
1158521426 18:58174456-58174478 CCCCTATCTGCCCAGGCGTTTGG + Intronic
1160318777 18:77871078-77871100 CCCCTCTGTGCACCTGCGCCGGG + Intergenic
1161313192 19:3606369-3606391 CCCCTGTGTGGCCCGGCGGGTGG - Intronic
1161325562 19:3662057-3662079 CCCCTGTGTGCACCGGGGGGTGG + Intronic
1161412424 19:4123905-4123927 CCCCTATGGGCCCCGGCTAGAGG - Exonic
1162462948 19:10824099-10824121 CCCCTGTGTGCCCCGGTCACTGG - Intronic
1164639291 19:29812449-29812471 CCCCTTTGCGCGCGGGCGGCCGG - Intronic
1166031470 19:40133754-40133776 CTACTATGTGCCCAGGAGGCTGG - Intergenic
925385304 2:3458003-3458025 CCCCTCTGGGCCCCTTCGGCTGG - Intronic
925508802 2:4601108-4601130 TCCCTATATGCCCCGCAGGCAGG + Intergenic
926054396 2:9765910-9765932 CCCCCGTGTGCCCCAGCTGCCGG - Intergenic
928983301 2:37157198-37157220 ACCCTAGGAGCCCCGGGGGCGGG - Intergenic
933807687 2:86012049-86012071 CCCCTGTGTGAACCGGCTGCAGG + Intergenic
937394293 2:121520922-121520944 CCCCTGTGTGACCCAGCTGCTGG - Intronic
937865460 2:126748267-126748289 CCCAGATGTGCCCCGTCTGCTGG - Intergenic
946095233 2:217269117-217269139 CCCCAATGTGCCACGGCCGGAGG + Intergenic
947876940 2:233473972-233473994 CCCCTTTGTGCCCTGGCTCCAGG + Intergenic
948791216 2:240377861-240377883 CCCCTCTCTGCCCCTGCAGCGGG - Intergenic
1170682955 20:18543130-18543152 GCCCGATGTGCTCCGGTGGCTGG + Exonic
1175228827 20:57460835-57460857 CCCCTATGTGCCCCATCTGAAGG + Intergenic
1175371398 20:58495516-58495538 CCCCCCTGTGCCCCGAGGGCAGG + Intronic
1179501215 21:41810113-41810135 CCCCTCCGTGCCCCGCCAGCGGG - Intronic
1180086340 21:45509529-45509551 CTCCTACGTGCACCTGCGGCCGG + Exonic
1181040778 22:20191675-20191697 CCCCTATGTGCCCCCATGGGTGG - Intergenic
1181427241 22:22851604-22851626 CCCCTATCTGCCCTGGCATCCGG + Intronic
1183601742 22:38844022-38844044 CCGCTCTGAGCCCGGGCGGCGGG + Intergenic
950847223 3:16026777-16026799 CTCCTGTGTGCCCTGGCTGCAGG + Intergenic
952241233 3:31532980-31533002 CCATGTTGTGCCCCGGCGGCGGG - Exonic
952796281 3:37242201-37242223 CCCGTTTGTGGCCCGGGGGCTGG + Intergenic
957386440 3:79502362-79502384 CCCCTCACTGCCCGGGCGGCGGG - Intronic
957630939 3:82715437-82715459 CCCCTCATTGCCCGGGCGGCAGG - Intergenic
962515042 3:136142353-136142375 CCCAAATGTCCCCTGGCGGCGGG + Intronic
962808691 3:138944872-138944894 CACCTCCGGGCCCCGGCGGCTGG - Exonic
963228798 3:142889193-142889215 CCCGTTTGTTCTCCGGCGGCAGG + Exonic
982157288 4:152535458-152535480 CCCCGATGTGAAGCGGCGGCTGG - Exonic
983176661 4:164596530-164596552 CCCCTCTGCGCCCCAGCGGCAGG + Intergenic
992069365 5:73135515-73135537 CCCCCATGAGCACTGGCGGCTGG - Intergenic
995032314 5:107494353-107494375 CCCCTCACTGCCCGGGCGGCAGG - Intronic
997309415 5:132867101-132867123 CCCCTCTGAGCGCTGGCGGCCGG + Intronic
1002106280 5:176880830-176880852 CCCCTATGTGCCCCGGCGGCCGG - Exonic
1003176866 6:3758272-3758294 CCCCTCAGTGCCCGGCCGGCGGG - Intergenic
1006929254 6:37677910-37677932 CCCCTATCTCCCCCTGCAGCTGG - Intronic
1013960086 6:115889211-115889233 CCCCTCACTGCCCGGGCGGCGGG - Intergenic
1018906991 6:168081230-168081252 CCCCTCAGTGCCCTGGCGGGAGG - Intronic
1019901584 7:4025378-4025400 CCGCTATGTGCCTCGGCTGGCGG - Intronic
1027956043 7:84880684-84880706 CCCCTCACTGCCGCGGCGGCGGG - Intergenic
1034427788 7:151023723-151023745 CCCCTCTGTGCCCAGGCTCCTGG - Exonic
1036656626 8:10681353-10681375 CCCCTCTGTGCCACGGCTGGTGG - Intronic
1038008715 8:23457329-23457351 CCCCTGTGAGCCCTGGCGGCCGG - Intronic
1040610514 8:48977838-48977860 GCCCCATGTGCCCTGGGGGCCGG - Intergenic
1041713443 8:60913337-60913359 CTCCTATGTGCCCCAGATGCAGG + Intergenic
1060263014 9:122092647-122092669 CCCCACTGTGCCCACGCGGCCGG + Intronic
1061193651 9:129095965-129095987 GCCCCAGGTGCCCCGGGGGCTGG - Intronic
1061488207 9:130930990-130931012 CCCCCATGTGCCCTGGGGACTGG - Intronic
1200003061 X:153072074-153072096 CCCGCACGTGCCCCGGAGGCAGG - Intergenic
1200004662 X:153077935-153077957 CCCGCACGTGCCCCGGAGGCAGG + Intergenic
1200143585 X:153913963-153913985 CCCTTTTGTGGCCTGGCGGCCGG + Intronic