ID: 1002107651

View in Genome Browser
Species Human (GRCh38)
Location 5:176888058-176888080
Sequence ATTGAAGTGATAGGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002107651_1002107658 24 Left 1002107651 5:176888058-176888080 CCAGCCTCCCCTATCACTTCAAT 0: 1
1: 1
2: 1
3: 24
4: 222
Right 1002107658 5:176888105-176888127 CATACGCCCCCGTGTCGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002107651 Original CRISPR ATTGAAGTGATAGGGGAGGC TGG (reversed) Intronic