ID: 1002107651 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:176888058-176888080 |
Sequence | ATTGAAGTGATAGGGGAGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 249 | |||
Summary | {0: 1, 1: 1, 2: 1, 3: 24, 4: 222} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1002107651_1002107658 | 24 | Left | 1002107651 | 5:176888058-176888080 | CCAGCCTCCCCTATCACTTCAAT | 0: 1 1: 1 2: 1 3: 24 4: 222 |
||
Right | 1002107658 | 5:176888105-176888127 | CATACGCCCCCGTGTCGCCATGG | 0: 1 1: 0 2: 0 3: 3 4: 16 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1002107651 | Original CRISPR | ATTGAAGTGATAGGGGAGGC TGG (reversed) | Intronic | ||