ID: 1002107738

View in Genome Browser
Species Human (GRCh38)
Location 5:176888525-176888547
Sequence CCGTGTCCATGCTATCCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002107738_1002107743 -5 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107743 5:176888543-176888565 CACGGGCTGCCCCAGTAGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 115
1002107738_1002107755 22 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107755 5:176888570-176888592 AGGGGAAAGGGAAGTGGTTTGGG 0: 1
1: 1
2: 5
3: 65
4: 628
1002107738_1002107751 9 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107751 5:176888557-176888579 GTAGAGGGGCTGGAGGGGAAAGG 0: 1
1: 0
2: 9
3: 112
4: 910
1002107738_1002107746 3 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107746 5:176888551-176888573 GCCCCAGTAGAGGGGCTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 263
1002107738_1002107756 23 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107756 5:176888571-176888593 GGGGAAAGGGAAGTGGTTTGGGG 0: 1
1: 1
2: 2
3: 57
4: 592
1002107738_1002107741 -7 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107741 5:176888541-176888563 GACACGGGCTGCCCCAGTAGAGG 0: 1
1: 0
2: 2
3: 10
4: 88
1002107738_1002107753 16 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107753 5:176888564-176888586 GGCTGGAGGGGAAAGGGAAGTGG 0: 1
1: 3
2: 26
3: 240
4: 1828
1002107738_1002107745 2 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107745 5:176888550-176888572 TGCCCCAGTAGAGGGGCTGGAGG 0: 1
1: 0
2: 4
3: 34
4: 330
1002107738_1002107748 4 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107748 5:176888552-176888574 CCCCAGTAGAGGGGCTGGAGGGG 0: 1
1: 0
2: 2
3: 58
4: 356
1002107738_1002107742 -6 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107742 5:176888542-176888564 ACACGGGCTGCCCCAGTAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 93
1002107738_1002107752 10 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107752 5:176888558-176888580 TAGAGGGGCTGGAGGGGAAAGGG 0: 1
1: 1
2: 30
3: 78
4: 729
1002107738_1002107754 21 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107754 5:176888569-176888591 GAGGGGAAAGGGAAGTGGTTTGG 0: 1
1: 0
2: 5
3: 82
4: 898
1002107738_1002107744 -1 Left 1002107738 5:176888525-176888547 CCTGCAGGATAGCATGGACACGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1002107744 5:176888547-176888569 GGCTGCCCCAGTAGAGGGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002107738 Original CRISPR CCGTGTCCATGCTATCCTGC AGG (reversed) Exonic
901229137 1:7632264-7632286 CCGTCTCCCTCCTATCCGGCTGG + Intronic
903379025 1:22884135-22884157 CAGTGTCCATGGTCCCCTGCGGG - Intronic
906716194 1:47971282-47971304 ACATGTCCCTGCTATCCTGGTGG + Intronic
1065460921 10:25963480-25963502 CTGTGTACATGTTATCCTCCAGG - Intronic
1075672614 10:124272874-124272896 CCGTGGCCATGCTATGGTCCTGG + Intergenic
1077063698 11:628535-628557 CCGTGTCCCTGCTGCGCTGCTGG - Intergenic
1077414187 11:2416972-2416994 TCGTGTCCATGGTTCCCTGCAGG - Intronic
1078009740 11:7563601-7563623 CCGCATCCATGGTATGCTGCAGG - Intronic
1079307914 11:19340458-19340480 CCCTGTCCTTGCTATTCTGATGG + Intergenic
1084494287 11:69495150-69495172 TCCTGTCCATGCTTTCCTGCTGG - Intergenic
1087287387 11:96279695-96279717 CTGTGTCCTTGCTAACCTACAGG + Intronic
1098232073 12:68381633-68381655 CCTTGTCCCTCCTATCTTGCCGG - Intergenic
1105256007 13:18744483-18744505 TCCTGCCCATCCTATCCTGCTGG + Intergenic
1108530508 13:51323305-51323327 CCTTCTACATGCTCTCCTGCAGG + Intergenic
1113293030 13:108926638-108926660 CCTTTTCCATGTTAGCCTGCTGG - Intronic
1116465140 14:45223027-45223049 CAGTCCCCATGCAATCCTGCAGG - Intronic
1119880946 14:78099141-78099163 CTGTGTCCATCCTAGCCTGGTGG + Intergenic
1202836006 14_GL000009v2_random:77545-77567 CCCTGCCCATCCCATCCTGCTGG - Intergenic
1130408361 15:83623447-83623469 CCATGCCCAGGCTAGCCTGCTGG - Intergenic
1132759250 16:1500909-1500931 ACGTGTCCAGGCAATCCTTCTGG - Intronic
1132932249 16:2464629-2464651 ACGTGTCCTTACCATCCTGCGGG + Exonic
1142389764 16:89791474-89791496 CAGTGACCATGCTGTCCAGCTGG + Exonic
1203141826 16_KI270728v1_random:1771840-1771862 CCATGTCCACACTATCCTCCTGG - Intergenic
1150275286 17:63894159-63894181 CCGTGTCCCTGCAGTCCTGATGG + Intergenic
1150277417 17:63908847-63908869 CCGTGTCCCTGCAGTCCTGATGG + Intergenic
1153135555 18:1913390-1913412 CCCTGTCCCTGCGTTCCTGCTGG - Intergenic
1161070958 19:2260738-2260760 CCGTGTCCAGGCTTTGCTTCTGG - Intronic
1202636632 1_KI270706v1_random:49817-49839 CCCTGCCCATCCCATCCTGCTGG + Intergenic
926926340 2:17992080-17992102 GCATGTCCATGAAATCCTGCTGG + Intronic
937883531 2:126885649-126885671 GCGGGTCCATCCTACCCTGCTGG + Intergenic
938278932 2:130051264-130051286 CCATGTCCATCCCATCCCGCTGG + Intergenic
938329914 2:130442139-130442161 CCATGTCCATCCCATCCCGCTGG + Intergenic
938360031 2:130679364-130679386 CCATGTCCATCCCATCCCGCTGG - Intergenic
938367281 2:130744880-130744902 CAGTCTCCATGCTGGCCTGCTGG - Intergenic
938436439 2:131286085-131286107 CCATGTCCATCCCATCCCGCTGG - Intronic
938979044 2:136508203-136508225 CTGTGTCAATGCTAGCCAGCTGG + Intergenic
1169503580 20:6184691-6184713 CTGTGTCCATGTCATTCTGCTGG + Intergenic
1170436739 20:16338193-16338215 CCGTGGCAATGCTCTCCAGCCGG + Intronic
1171882767 20:30630748-30630770 CCCTGCCCATCCCATCCTGCTGG + Intergenic
1175224620 20:57437786-57437808 CCCTCTCCCTGCTGTCCTGCTGG - Intergenic
1175844658 20:62052083-62052105 CGGTGGCCATGCTGTGCTGCGGG - Intronic
1175873508 20:62219242-62219264 ACGTGTCCAGGCTCTGCTGCCGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1180053952 21:45347539-45347561 ACGTGTCCCGGCTTTCCTGCGGG + Intergenic
1180364238 22:11924496-11924518 CCCTGCCCATCCCATCCTGCTGG - Intergenic
1184790294 22:46695887-46695909 CCCAGTCCCTGCTGTCCTGCTGG - Intronic
1185118652 22:48952532-48952554 CCCTGTGCCTCCTATCCTGCAGG - Intergenic
1185410390 22:50678614-50678636 CCTTGTCCGTGCTATGCAGCTGG - Intergenic
957769819 3:84676191-84676213 CCGTGTGCATGCTTGCCAGCAGG + Intergenic
958482002 3:94654540-94654562 GAGTGAGCATGCTATCCTGCTGG - Intergenic
958610807 3:96423744-96423766 CCGTGTCCACGATATTCTGCTGG - Intergenic
960131601 3:114061982-114062004 CAGTGGCCATGGTATGCTGCAGG + Intronic
968349985 3:198046064-198046086 CCTTGTCCAGCCCATCCTGCTGG + Intergenic
969582522 4:8073455-8073477 CAGGCTCCATCCTATCCTGCAGG + Intronic
969662693 4:8539455-8539477 CGGTGTCCTTGCTATACTGAGGG + Intergenic
970347293 4:15164978-15165000 CCATGTCCATGCTCTCTTCCTGG - Intergenic
970363359 4:15332991-15333013 ACATGTCCAGACTATCCTGCTGG + Intergenic
973366445 4:49213187-49213209 CCCTGCCCATCCCATCCTGCTGG + Intergenic
973394166 4:49579247-49579269 CCATGCCCATCCCATCCTGCTGG - Intergenic
973795356 4:54419922-54419944 ACATGTCCAGGCTAGCCTGCTGG + Intergenic
982236650 4:153257257-153257279 CTGTTTCCATGCTCTCGTGCTGG - Intronic
983457845 4:167986441-167986463 CCTAGTCCATGCTATGCTCCAGG - Intergenic
983524989 4:168751681-168751703 ACGTGTGCATGCTAACCTCCTGG - Intronic
1202763948 4_GL000008v2_random:135689-135711 CCCTGCCCATCCCATCCTGCTGG + Intergenic
986071393 5:4288049-4288071 CCATGTCCATGGCATCCTGGAGG - Intergenic
988512622 5:31878497-31878519 ACGTGTCCATGCTCTTCTCCAGG - Intronic
991108739 5:62872458-62872480 CTGTGTCCCTGATATTCTGCAGG - Intergenic
992160403 5:73995247-73995269 CAGTGTCCTTGCTGTCCTGCAGG + Intergenic
996679477 5:126215547-126215569 ATGTGCCAATGCTATCCTGCTGG - Intergenic
998156327 5:139788871-139788893 CCGTGGCCTTGCTCTCCTCCAGG + Intergenic
1001242510 5:170081229-170081251 CTGTGTTCAGGCTATCCTGGGGG - Intronic
1002107738 5:176888525-176888547 CCGTGTCCATGCTATCCTGCAGG - Exonic
1019619777 7:1986193-1986215 CGGTGTCCTTTCTCTCCTGCCGG - Intronic
1019789850 7:3004121-3004143 CCGTCTCCATGGTAACCAGCAGG - Intronic
1021790452 7:24199446-24199468 CCTTGTCCATCCCATCCAGCAGG + Intergenic
1023180814 7:37481343-37481365 CCTTGTTGATGCCATCCTGCAGG + Intergenic
1023581660 7:41690366-41690388 CTGTGTCCAAGCTGCCCTGCGGG + Exonic
1027248059 7:76380314-76380336 CCGTGTCTATGCCATCGGGCGGG + Intergenic
1033667872 7:143460367-143460389 CCCTGTCCAGACTATCCTGCTGG - Intergenic
1036080223 8:5547217-5547239 CCTTGTCCATCATATCATGCCGG - Intergenic
1036288334 8:7463889-7463911 CCATGTCGATTCTATCCTGTTGG + Intergenic
1036333141 8:7847639-7847661 CCATGTCGATTCTATCCTGTTGG - Intergenic
1040105287 8:43538086-43538108 CCCTGTCCAGCCCATCCTGCTGG - Intergenic
1050120279 9:2300568-2300590 CCTGGCCCATGCTATCCTTCAGG + Intergenic
1053169302 9:35867551-35867573 CAGTGGCCATGCCATTCTGCTGG - Intergenic
1057231806 9:93325734-93325756 CCCTGCCCCTGCTATCCTTCTGG + Intronic
1059935944 9:119310752-119310774 CCGTGTCCATGCTAGCATACAGG + Intronic
1062191242 9:135248969-135248991 CAGTGGCCATGCTACCCTGAGGG + Intergenic
1062323583 9:136002400-136002422 CCGTGACCGTGGTATCCTGCAGG + Intergenic
1203544696 Un_KI270743v1:120562-120584 CCCTGCCCATCCCATCCTGCTGG + Intergenic