ID: 1002108532

View in Genome Browser
Species Human (GRCh38)
Location 5:176892492-176892514
Sequence CCCTGGGGCTCTTAAGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002108532 Original CRISPR CCCTGGGGCTCTTAAGCTAC TGG (reversed) Intronic
901040338 1:6359544-6359566 CCCGCGGGCTCTTAGGCTGCCGG + Intronic
907322274 1:53612039-53612061 CCCAGGGGGTCTCAAACTACTGG + Intronic
907654525 1:56328778-56328800 CCTTGGGGCTCTTAAGCTCTCGG + Intergenic
911078037 1:93898830-93898852 CCCAGGGGCTCTTGAACTCCCGG + Intronic
918310151 1:183279886-183279908 CCCTGGGGCTGTAAAGATAAAGG - Intronic
920286518 1:204883645-204883667 CCCTGCTCCTCTTCAGCTACAGG - Intronic
921581258 1:216898959-216898981 CCCTGAGGCACTTGAGCTAATGG - Intronic
1064970876 10:21065729-21065751 CCCTGGGGCTTTTCAGCTGCAGG - Intronic
1066237096 10:33495941-33495963 CCCTGGGCCTCTTAAAGTGCTGG + Intergenic
1067836213 10:49643466-49643488 CCCCGGGGCTCTGAAGGCACTGG + Intronic
1070096113 10:73339797-73339819 ACCTGGGGCTCTTCAGTTTCTGG - Intronic
1071089252 10:81899671-81899693 CCCTGGGACCATGAAGCTACAGG + Intronic
1071666517 10:87564020-87564042 CCCTGGGGCTCAGCAGCTCCAGG + Intergenic
1075702863 10:124480374-124480396 CTTTGGGACTCTTAAGCCACTGG - Intronic
1077583051 11:3429568-3429590 TCCTGGGGCTCCAAAGCTGCTGG + Intergenic
1077726122 11:4676567-4676589 CCCTAGTGTTCTTTAGCTACTGG - Intergenic
1078448142 11:11420432-11420454 CACTGAGACTCTGAAGCTACTGG + Intronic
1083634365 11:64112262-64112284 CCCTGGGCCTCTCAAAGTACTGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084239963 11:67812371-67812393 TCCTGGGGCTCCGAAGCTGCTGG + Intergenic
1085035888 11:73299800-73299822 CCCTGAGGCTCTCAAGCTGCTGG - Intergenic
1088821371 11:113460486-113460508 CCAGGGAGCTCTTAAGCAACAGG - Intronic
1090021299 11:123131090-123131112 CCCTTGGGCTCTTAAAGTGCTGG + Intronic
1091738984 12:2946425-2946447 CATTGGGGCTCTCAAGCCACAGG + Intergenic
1096290715 12:50340458-50340480 GCCTTGGCCTCTCAAGCTACTGG - Intronic
1096621888 12:52870460-52870482 CCCAGAGGCTCTGAAGCGACAGG - Intergenic
1103212785 12:119178955-119178977 CCCTGGGTTTATTAAGCTCCTGG + Exonic
1113610773 13:111643555-111643577 CCCTTGGGCTCTGAAGCTTGTGG + Intronic
1118475951 14:66117159-66117181 CCCGGGGTCTCTAAATCTACTGG + Intergenic
1127520529 15:59739121-59739143 CCCTGGGGCACTAAAGGAACCGG - Intergenic
1129172249 15:73815295-73815317 CCCTGAGGCTATAAGGCTACAGG - Intergenic
1129712996 15:77830638-77830660 TCCTTGGGCTCGTAAGCCACTGG - Intergenic
1129916596 15:79279269-79279291 CCCTGGTGGTCTTAAGCTGGAGG + Intergenic
1133097390 16:3457194-3457216 GCCTGGGCCTCTTAAAATACTGG - Intronic
1133108855 16:3533560-3533582 CCCTGGAGCACTTAAGCAAAAGG + Intronic
1142373048 16:89693557-89693579 CCTTGGGAATGTTAAGCTACAGG + Intronic
1146054878 17:29576025-29576047 CCCTGGGGCTCAGAACCTACTGG + Intronic
1147606001 17:41774018-41774040 CCCTGGGGCTTCTCAGCTAAGGG + Intronic
1147664549 17:42138337-42138359 ACCCTGGGCTCTTAAGCTTCTGG - Intronic
1153074567 18:1148038-1148060 CCCTGGGGCTCTAAATAAACTGG + Intergenic
1159942366 18:74418173-74418195 CACTGGGTTTCTTAAACTACTGG - Intergenic
1160238602 18:77106012-77106034 CCTTGGGGCTCTTCAGCTGAGGG + Intronic
1163232122 19:16011583-16011605 TCCTTGTGCTCTTAAGTTACAGG + Intergenic
1168641125 19:58032434-58032456 TCCTGGGACTCTTAATCTCCAGG + Intergenic
929969325 2:46560134-46560156 CCCTGAGGGTCTGAAGCTATGGG - Intronic
938321734 2:130370788-130370810 CCCTGGGTCTCCTAATCTTCAGG + Intronic
938444610 2:131367246-131367268 CCCTGGGGCTCCCAGGCTTCGGG - Intergenic
943780195 2:191815155-191815177 ACCTGGGGCTCTTAAACTGATGG - Intergenic
944338658 2:198568436-198568458 ACCTGGGGCTCTGAAAGTACTGG + Intronic
945291413 2:208131199-208131221 CCCTGGTGGTCTTTAGCTAAAGG + Intergenic
946173909 2:217911133-217911155 GCCTGGGGACCTTAAGCTCCAGG - Intronic
947864617 2:233387773-233387795 CTCTGGGGCTCAGAAGCTCCAGG - Intronic
948597971 2:239092572-239092594 CCCTGGGGTTCAGAAGCTTCTGG + Intronic
1169039032 20:2477717-2477739 CCCAGGTGGTCTTAAGCTCCTGG - Intronic
1169080269 20:2794165-2794187 CCCTAGGGCTCTTAAACCGCAGG + Exonic
1173819314 20:46010461-46010483 TCCTCTGGCTCTTACGCTACAGG + Exonic
1173837282 20:46134355-46134377 CCCAGGGGCTCTTCAACTCCTGG - Intergenic
1174824044 20:53753015-53753037 CTCTGGGGCTTTCAGGCTACAGG + Intergenic
1176313090 21:5164985-5165007 TCCTGGGGCTCTCAAGCCACAGG + Intergenic
1179167579 21:38946799-38946821 CCCTGGGGCTCCTGCCCTACAGG - Intergenic
1179843958 21:44097045-44097067 TCCTGGGGCTCTCAAGCCACAGG - Intronic
1180993732 22:19954041-19954063 CCCTGGGGCTGTGAATCTGCAGG + Intronic
1181926605 22:26364563-26364585 GCCTGGGTGTCTTAGGCTACCGG + Intronic
1182774188 22:32818861-32818883 TCATGGGGCTCTGAAGCCACGGG + Intronic
1184666564 22:45992421-45992443 CCCTGGGGCTCTCATGGCACTGG - Intergenic
1184800554 22:46756187-46756209 ACCTGGGGCCTTTGAGCTACAGG + Intergenic
951389936 3:22090393-22090415 CACTTGGGCTCTTAAGTCACTGG - Intronic
951918707 3:27829444-27829466 CCCTAGAGCTATTAAGCTGCAGG + Intergenic
952866471 3:37858490-37858512 CCCTGGGGGCCTTAAGCCCCTGG - Intergenic
953682416 3:45049796-45049818 TCCTGGGGGTCTTTGGCTACAGG + Intergenic
954453652 3:50585418-50585440 CCCTGGGGTTCTCAACCTCCTGG + Intergenic
955697939 3:61655364-61655386 CCCTGAAGATCTTAATCTACAGG - Intronic
957873551 3:86116217-86116239 ACCTGGGGCTCTTAAAGTGCTGG - Intergenic
960943953 3:122953283-122953305 GCCTGGGGCTCTGAAGCTGGTGG - Intronic
961298950 3:125909563-125909585 TCCTGGGGCTCCAAAGCTGCTGG - Intergenic
965128094 3:164656205-164656227 CCCTGGCTTTCTTAAACTACAGG + Intergenic
969815636 4:9685366-9685388 TCCTGGGGCTCCAAAGCTGCTGG - Intergenic
969903412 4:10370959-10370981 TCCTGGGGCTCTTAAACATCAGG + Intergenic
975561988 4:75716956-75716978 CCCATGGACTCCTAAGCTACTGG + Intronic
979284698 4:118909352-118909374 CCCTGGGGGTATTGACCTACAGG + Intronic
979946891 4:126843574-126843596 CCTTGGGGCTCTGAGGTTACTGG + Intergenic
982498996 4:156130605-156130627 CCCTGGGTATCTAAAGCTTCTGG - Intergenic
982913356 4:161174318-161174340 GCCTGGGCCTCCCAAGCTACTGG - Intergenic
988619986 5:32813031-32813053 CCCTGTAGCTCTTAAGCTACTGG + Intergenic
988768960 5:34411770-34411792 TCCTGGGCCTCTTAGGCTGCAGG - Intergenic
998461966 5:142316493-142316515 CCCTGGGGTTCTTAAGATTGGGG - Intronic
1002108532 5:176892492-176892514 CCCTGGGGCTCTTAAGCTACTGG - Intronic
1006409865 6:33866767-33866789 CTCTGAGGCTCTTCACCTACAGG - Intergenic
1012759578 6:103281725-103281747 TCCTTGTGCTGTTAAGCTACAGG + Intergenic
1015256343 6:131183512-131183534 CCCTGTGGCCCTTGAGCTGCTGG + Intronic
1018765705 6:166931576-166931598 CCCTGGGACCCCTCAGCTACCGG + Intronic
1020013903 7:4820304-4820326 CCCTGGGGCTCCTGGGCTCCCGG - Intronic
1020074400 7:5248359-5248381 GCCTGGAGCCCTTGAGCTACAGG + Intergenic
1020700956 7:11482663-11482685 CCCTGTTGCTCTTAAGATAAAGG + Intronic
1022031252 7:26493455-26493477 CTCTGGGGCACTTTAGGTACAGG + Intergenic
1023849856 7:44144613-44144635 CCCTGGGCCTCTTGAGCCTCAGG + Exonic
1025204694 7:56985448-56985470 GCCTGGAGCCCTTGAGCTACAGG - Intergenic
1025667243 7:63591487-63591509 GCCTGGAGCCCTTGAGCTACAGG + Intergenic
1026966014 7:74440662-74440684 CCCTGGGCCACTTAAGATACAGG + Intergenic
1027471627 7:78581407-78581429 CCCTGGTGGTATTAAACTACTGG - Intronic
1028446082 7:90926087-90926109 CACTGGGGCTCTAAAGACACTGG - Intronic
1030524518 7:110637325-110637347 CCCACGGGCTTCTAAGCTACAGG + Intergenic
1031688670 7:124763922-124763944 TCCAGGGGCTCTCAAGCTAGTGG - Intronic
1034980270 7:155471411-155471433 CCTTGGGGCTCTGAATCCACAGG - Intergenic
1041362427 8:57067221-57067243 CCCAGGGTCTCTGAACCTACGGG - Intergenic
1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG + Intergenic
1048773617 8:137921389-137921411 CCCAGGAGTTCTTAAGCTACTGG + Intergenic
1049408755 8:142463210-142463232 CCCTCGTGCCCTAAAGCTACAGG - Intronic
1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG + Intronic
1058107703 9:100991784-100991806 CCCTGGGGGACTTAAACTATTGG + Intergenic
1058433411 9:104939590-104939612 CCCTGGGGTTCTAGAGATACGGG + Intergenic
1058487587 9:105457978-105458000 CCTTGGGGCTCTGCAGTTACTGG - Intronic
1060300022 9:122369719-122369741 CCCTGGGGCTCTCAGGGTGCCGG - Intergenic
1061798586 9:133102419-133102441 CCTTGGGGCTCAGAAGCTTCAGG - Intronic
1188207867 X:27381441-27381463 CTCTGGGGCTCTTCAGTTCCTGG + Intergenic
1188789838 X:34394447-34394469 TCCTGCAGCTCTTCAGCTACTGG - Intergenic
1194165043 X:90505690-90505712 CCCAGGGGCTCTTCAGTTAGTGG - Intergenic
1199162447 X:144628884-144628906 CCCTGGGGCTCTTCAGTCAGTGG - Intergenic
1199191800 X:144980101-144980123 CCCAGGGGCTCTTCAGTTAGCGG - Intergenic
1200511308 Y:4083493-4083515 CCCAGGGGCTCTTCAGTTAGTGG - Intergenic