ID: 1002108581

View in Genome Browser
Species Human (GRCh38)
Location 5:176892741-176892763
Sequence CTGGATAATAAGGCCGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002108572_1002108581 26 Left 1002108572 5:176892692-176892714 CCTATTGCCCCAAACTGGACACT 0: 1
1: 0
2: 1
3: 8
4: 133
Right 1002108581 5:176892741-176892763 CTGGATAATAAGGCCGCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 54
1002108574_1002108581 18 Left 1002108574 5:176892700-176892722 CCCAAACTGGACACTTATCTTTG 0: 1
1: 0
2: 3
3: 14
4: 179
Right 1002108581 5:176892741-176892763 CTGGATAATAAGGCCGCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 54
1002108573_1002108581 19 Left 1002108573 5:176892699-176892721 CCCCAAACTGGACACTTATCTTT 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1002108581 5:176892741-176892763 CTGGATAATAAGGCCGCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 54
1002108575_1002108581 17 Left 1002108575 5:176892701-176892723 CCAAACTGGACACTTATCTTTGG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 1002108581 5:176892741-176892763 CTGGATAATAAGGCCGCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002108581 Original CRISPR CTGGATAATAAGGCCGCTCC AGG Intronic
900732210 1:4269503-4269525 CTGGATAATAAAGCCGCCAGTGG - Intergenic
905336423 1:37247745-37247767 CTGGAGAGTGAGGCCGATCCTGG + Intergenic
907317370 1:53581025-53581047 CTGGATAAGAACGCCTCTCTGGG + Intronic
915528400 1:156489869-156489891 CTGGGTAATAAGGCAGGGCCTGG - Intronic
923618777 1:235560109-235560131 CTGGATAAGATGGACACTCCAGG + Intronic
1064209069 10:13348093-13348115 CTGAATAAAAATGCCGCGCCCGG + Exonic
1071478011 10:86041550-86041572 CAGGATACTCAGGCTGCTCCAGG - Intronic
1082239029 11:49852551-49852573 CTGGACACCATGGCCGCTCCCGG + Intergenic
1083179269 11:60973847-60973869 CTGAAAAATATGGCCTCTCCAGG + Intronic
1088470875 11:110186739-110186761 CTGCTTCATAAGTCCGCTCCAGG - Intronic
1094155112 12:27331028-27331050 CTGGAGAGCAAGGCAGCTCCAGG + Intergenic
1097510384 12:60531456-60531478 CTGCATAATAAGGCTTCTCCAGG - Intergenic
1100795330 12:98176041-98176063 CTGGATCACAAGGCCACTTCTGG + Intergenic
1102484295 12:113245702-113245724 TTGGATAAAAGGGCCCCTCCTGG - Intronic
1105206532 13:18230531-18230553 CGGGATAATAAGGCAGACCCGGG - Intergenic
1130509976 15:84581524-84581546 CTGGGTCAAAAGGCCTCTCCTGG + Intergenic
1132083201 15:98884879-98884901 CTGGATTAAAAGGCTGTTCCAGG + Intronic
1137542156 16:49372087-49372109 TTGGATAATAAGGCCGGACACGG + Intergenic
1143528193 17:7484398-7484420 TTGGAGAAGAAGGCGGCTCCCGG + Exonic
1146713984 17:35068339-35068361 CTGTATAAAATGGCCTCTCCTGG + Intronic
1146949738 17:36897630-36897652 CTGGATAACAGGGCAGCACCTGG + Intergenic
1157948030 18:52003003-52003025 CTGGATGATCAGGCTGCTCTTGG - Intergenic
1161894655 19:7071287-7071309 CTGTATAATAAGGTAGCTGCTGG + Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
939265124 2:139862933-139862955 CTGGATAATAAGGTAATTCCAGG - Intergenic
944871984 2:203921335-203921357 CTGGATAATAAGGATACTACAGG - Intergenic
1168752433 20:292378-292400 CTGGCTATTCAGGCCCCTCCTGG + Intergenic
1169339476 20:4785437-4785459 CTGGAGAATAAAGCCGCTGCTGG - Intronic
1170364621 20:15585494-15585516 CTTGGTAAAAAGGACGCTCCAGG - Intronic
1180722912 22:17922718-17922740 TTGGAGAATAAGGACCCTCCTGG - Intronic
951182191 3:19671728-19671750 CTGGAGAATGAGGTGGCTCCTGG + Intergenic
953625249 3:44565603-44565625 CTGGGTCATAAGGAGGCTCCAGG - Exonic
953790301 3:45942377-45942399 CTGGATCCTGAGGCTGCTCCTGG + Intronic
955089696 3:55737322-55737344 CTGGATATTAATGCTGCTGCCGG - Intronic
955918657 3:63931538-63931560 CTGGCTAATGAGGCCGCTACAGG + Intronic
962867034 3:139455719-139455741 CTGGATAAGAAGGCAGGTACTGG - Intronic
966855809 3:184193231-184193253 CTGGAAAATGAGGCCTCACCAGG - Exonic
982395559 4:154911759-154911781 CTGGATCATAAAGCTGCTCTCGG + Intergenic
989036616 5:37179630-37179652 CTGAATAATAAGGCCTCTCAAGG - Intronic
990900511 5:60744052-60744074 CTGGAACATAAGCCGGCTCCAGG - Intergenic
996413013 5:123179606-123179628 CTTGATACTAAGGCCGTTCTAGG - Intronic
998687244 5:144542545-144542567 CTGGAAAATAAGGTGGCTTCTGG + Intergenic
1001004530 5:168038769-168038791 CTGGTTCCTAAGGCCCCTCCTGG + Intronic
1001004554 5:168038851-168038873 CTGGTTCCTAAGGCCCCTCCTGG + Intronic
1002108581 5:176892741-176892763 CTGGATAATAAGGCCGCTCCAGG + Intronic
1010839325 6:80629610-80629632 CTGGATCATATGGTGGCTCCAGG - Intergenic
1015869281 6:137759753-137759775 CTGGATCATAAGGTCACTCTTGG + Intergenic
1018574380 6:165244011-165244033 CTGGTCCATAAGGCCCCTCCAGG + Intergenic
1019623530 7:2003892-2003914 CTGGATAATCCGGCCACTGCTGG + Intronic
1019766795 7:2857492-2857514 CTAGATAATAAAGCAGCTCCTGG - Intergenic
1022389016 7:29927513-29927535 CTGGATCAGAGGGCTGCTCCTGG + Intronic
1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG + Intergenic
1025252566 7:57361620-57361642 CTGGATCATGTGGCCACTCCTGG - Intergenic
1027269090 7:76510544-76510566 CTGGTTAATCAGGCTGCCCCAGG - Exonic
1031472750 7:122186760-122186782 CTGGATCATATGGTTGCTCCAGG - Intergenic
1033882721 7:145906028-145906050 CTGAATAATAAGACAGATCCTGG + Intergenic
1037648789 8:20818058-20818080 CAGGATAATCAGGCAGCTCTGGG - Intergenic
1049794151 8:144488901-144488923 CTGGATCAGAAGCCCCCTCCTGG + Intronic
1052977830 9:34424659-34424681 CTGGATTCTCAGGCCACTCCTGG - Intronic
1061852908 9:133426273-133426295 CTCGGTAATGAGGCAGCTCCAGG - Exonic