ID: 1002113280

View in Genome Browser
Species Human (GRCh38)
Location 5:176936200-176936222
Sequence CATTGTGACTAGCATGTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002113280_1002113283 12 Left 1002113280 5:176936200-176936222 CCTATTACATGCTAGTCACAATG 0: 1
1: 0
2: 2
3: 31
4: 233
Right 1002113283 5:176936235-176936257 CAAAGTGTCTGTGATTCTCATGG 0: 1
1: 0
2: 2
3: 38
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002113280 Original CRISPR CATTGTGACTAGCATGTAAT AGG (reversed) Intronic
902663741 1:17923181-17923203 CATTGTGCCTGGCATATAGTAGG - Intergenic
904899376 1:33844336-33844358 CACTGTGTCTAGCATCTAATGGG + Intronic
906019344 1:42613704-42613726 CATTATAATTAGCATATAATGGG + Intronic
906656237 1:47550222-47550244 CATTGTGATAAGCATGTTCTGGG + Intergenic
906728995 1:48064977-48064999 CACTGTGCCTAGCATGTAGTAGG - Intergenic
906931069 1:50169989-50170011 CATAGTGTCTAGCATGTGGTAGG + Intronic
907061187 1:51427341-51427363 CATAGTGACAAGTATGTAATAGG - Intronic
907077855 1:51594566-51594588 CATTGTCCCTAGCATATAGTTGG - Intronic
907193327 1:52666635-52666657 CATTGTGTCTGGCATGTTATGGG + Intronic
907575673 1:55523673-55523695 CATAGTGTCAGGCATGTAATGGG - Intergenic
908508200 1:64827112-64827134 AATTGTGAATTGCATGAAATTGG + Intronic
908694397 1:66822073-66822095 AATTGTGCCTAGTATGTAATTGG - Intronic
909356040 1:74711300-74711322 CTTTGTGCCTCACATGTAATTGG - Intronic
912727181 1:112068694-112068716 CATAGTGCCTGGCATGTAATAGG + Intergenic
914256666 1:145965565-145965587 CATTGTGTCTGGCATATAGTAGG - Intronic
915372957 1:155366962-155366984 CATTGCAACTAGCCTGTAATGGG + Intronic
916484046 1:165242144-165242166 CATGGTGCCTGGCATGCAATAGG - Intronic
917008446 1:170443348-170443370 CACAGTGTCTAGCATGTAGTAGG - Intergenic
917719861 1:177777050-177777072 CATTGTGCCTAGCACATAACAGG + Intergenic
918806997 1:189060836-189060858 CATTGTAACTGGCATGAGATGGG - Intergenic
920825934 1:209424244-209424266 CCTAGTACCTAGCATGTAATAGG - Intergenic
921372512 1:214438869-214438891 CATTGTGCTTAGCATATAGTAGG - Intronic
922234836 1:223714763-223714785 CATTGTGCCCAGCATATAGTAGG - Intronic
923964672 1:239124192-239124214 TAGTGTGACTAGAATTTAATAGG + Intergenic
1063748079 10:8909048-8909070 CATTGTGCCTAGCATATATTAGG - Intergenic
1064063539 10:12160718-12160740 CACAGTGTCTTGCATGTAATAGG + Intronic
1064136934 10:12758994-12759016 CATGCTCACTGGCATGTAATGGG + Intronic
1064851252 10:19711367-19711389 CACAGTGACTAGCAAATAATAGG - Intronic
1064985506 10:21206405-21206427 CCATGTGACAAGCATGTAAAAGG - Intergenic
1065692813 10:28352928-28352950 CACAGTGCCTAGCAAGTAATAGG - Intergenic
1066314934 10:34235646-34235668 GAATGTGACTGGCATGAAATTGG + Intronic
1068001122 10:51335456-51335478 GATAATGACTAGCTTGTAATGGG - Intronic
1068785241 10:60965499-60965521 CATGGTGCCTGGCATGTAGTAGG + Intronic
1070205968 10:74261852-74261874 CATTGTTCTGAGCATGTAATGGG + Intronic
1071724984 10:88189638-88189660 CACTGTGCCTGGCATGCAATAGG + Intergenic
1071775665 10:88785180-88785202 CATGGTGCCTTGCATATAATAGG - Intergenic
1073130195 10:101183494-101183516 CATTATAATTAGCATATAATGGG - Intergenic
1073809619 10:107138111-107138133 TATGGTGACTAGCACATAATAGG + Intronic
1074182003 10:111073889-111073911 CATTGTGCCTAGCATGTGGTTGG + Intergenic
1074924925 10:118059135-118059157 CATAGTGCATTGCATGTAATAGG + Intergenic
1078559232 11:12356422-12356444 CAGGGTGACTGGCAAGTAATGGG + Intronic
1080190670 11:29544156-29544178 CATTTTAAATAGCATGTACTTGG - Intergenic
1080264152 11:30384122-30384144 CATGATATCTAGCATGTAATAGG - Intergenic
1080915613 11:36655509-36655531 CACAGTGACTAGAATTTAATAGG + Intronic
1081334749 11:41850858-41850880 CAATGTGCCTAGCACATAATAGG - Intergenic
1082063493 11:47880274-47880296 CATAGTGACTAGCACATATTAGG + Intergenic
1084967756 11:72753211-72753233 CACTGGGACTAGCATGCAGTAGG - Intronic
1086230446 11:84563130-84563152 CACTGTCGCTAGCATATAATAGG + Intronic
1086778962 11:90878500-90878522 CATTGTTACTAGAATCCAATAGG - Intergenic
1087053075 11:93905588-93905610 CATCATGCCTGGCATGTAATAGG + Intergenic
1087769662 11:102194518-102194540 CATAGTGCCTGGCATGTAACTGG - Intronic
1089156178 11:116404504-116404526 CTCAGTGCCTAGCATGTAATAGG - Intergenic
1089203541 11:116740181-116740203 CATAGTGTCTGGCATGTAGTAGG - Intergenic
1089711999 11:120322152-120322174 CATTGTGACTAGCACATAACAGG + Intergenic
1089720448 11:120414489-120414511 TATAGTGCCTGGCATGTAATGGG - Intronic
1089992349 11:122873434-122873456 CACTGTGCCTGGCATATAATGGG + Intergenic
1091129721 11:133135284-133135306 CCTTATGATTAGCATGTGATTGG + Intronic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1091608812 12:1985071-1985093 GATTGTGACTGTCATGTCATGGG + Intronic
1093114137 12:15188696-15188718 AATTGTATTTAGCATGTAATAGG + Intronic
1093258191 12:16899184-16899206 CATTGTGTCTTGCATGTAATGGG + Intergenic
1093939372 12:25036210-25036232 CATAGTGCCTAGCATATAGTAGG + Intronic
1094072373 12:26431876-26431898 CATTGGTACCAGCATGTATTAGG + Intronic
1095594388 12:43942240-43942262 AACTGTGTCTGGCATGTAATAGG + Intronic
1096104381 12:48988009-48988031 CATTGTACCTTGCACGTAATAGG + Intergenic
1097396412 12:59080458-59080480 TATAGTACCTAGCATGTAATTGG + Intergenic
1097640956 12:62181322-62181344 CATAGTGTCTGGCATCTAATAGG - Intronic
1098544954 12:71701491-71701513 AATTGTGAATAGCAATTAATGGG - Exonic
1098794447 12:74870735-74870757 CATAGTGTCCAGCATGTAGTAGG - Intergenic
1098985790 12:77010483-77010505 CATAGTGCCTAGCATATAATAGG + Intergenic
1099850166 12:88084446-88084468 AATTGTTACTTGCATGTGATTGG - Intronic
1099916906 12:88906262-88906284 CATTGTGACTAGCATTGGGTAGG - Intergenic
1100467024 12:94855412-94855434 CTTTGTGACTAGCATATAGCTGG - Intergenic
1101230639 12:102737616-102737638 CATTGTGCCTGGCATATTATAGG + Intergenic
1101645267 12:106625686-106625708 CATGGAGTCTAGCATGTAGTAGG - Intronic
1101990391 12:109479319-109479341 CATTGTGATTAGGATTAAATGGG - Intronic
1104119244 12:125783213-125783235 AACAGTGACTAGCATGTAGTAGG + Intergenic
1106022257 13:25926543-25926565 TACTGTGTCTGGCATGTAATAGG + Intronic
1108111580 13:47079647-47079669 CATAGTGCCTGGCATGTAGTAGG + Intergenic
1108225230 13:48282627-48282649 CATTTTTGCTAACATGTAATGGG + Intergenic
1109036692 13:57271705-57271727 CATTGTGAATGGGATGAAATTGG + Intergenic
1110823438 13:79943570-79943592 CCCTGTGACTAGCATGAAGTGGG - Intergenic
1113384102 13:109832455-109832477 CATTCTGACTGGCATGAGATGGG - Intergenic
1114718474 14:24854029-24854051 CACAGTGACTAGCATGTAGTAGG + Intronic
1115275028 14:31598703-31598725 AATTGTGACTTGCATATAAGAGG + Intronic
1117127298 14:52643199-52643221 AAATGTGACAAGCATTTAATAGG - Exonic
1117715024 14:58571723-58571745 CAATGTGACAAGCATGTATTGGG + Intergenic
1117726336 14:58678168-58678190 TACAGTGACTAGCATGTAACTGG + Intergenic
1119171322 14:72538387-72538409 CAGTGTGACTATCATTTATTTGG - Intronic
1120873240 14:89356724-89356746 CATGGTGCCTGGCATGTAGTAGG - Intronic
1125279455 15:38028019-38028041 CATGGTGTCTTGCATATAATAGG + Intergenic
1125499689 15:40231808-40231830 CATTGTACCTAGCAGGTACTCGG + Intergenic
1125743036 15:41980682-41980704 AACAGTGACTGGCATGTAATGGG + Intergenic
1127023653 15:54779444-54779466 CATGGTGACTAGAATGTCAAAGG - Intergenic
1130671546 15:85917339-85917361 CATAGTGTCTGGCATGAAATTGG + Intergenic
1132521197 16:390194-390216 CAGTTTGACTATGATGTAATTGG - Intergenic
1133112090 16:3554153-3554175 CATTCTTCCTAGCAGGTAATAGG + Intronic
1135520332 16:23171958-23171980 CATTGTGAATGGCATTTCATGGG - Intergenic
1135520622 16:23174758-23174780 AATTGTGAATTGCATGTCATGGG + Intergenic
1137884707 16:52090266-52090288 CATTGTGACTATCATGTATGTGG + Intergenic
1138021610 16:53487880-53487902 CATTCTAACAGGCATGTAATGGG - Intronic
1139291781 16:65864850-65864872 CATGGTGACTAGCTTCTAACAGG + Intergenic
1140103065 16:71935167-71935189 CAATGTGACTAGCAGTTAAATGG + Intronic
1141258356 16:82425563-82425585 CAATGTGCTTAGCCTGTAATTGG + Intergenic
1141335478 16:83151014-83151036 CATGGTGACAAGCATATAGTAGG + Intronic
1146772226 17:35579307-35579329 AATTGTAACTAGCATGCACTGGG + Intronic
1151838723 17:76601912-76601934 CATTATAATTAGCATATAATGGG + Intergenic
1153005414 18:494399-494421 AATGGTGGCTAGTATGTAATAGG - Intronic
1153207004 18:2714383-2714405 TATTGTGAGTAGCATTTAGTTGG + Intronic
1153753262 18:8255354-8255376 CATTGTCTGTAGCATGTTATAGG - Intronic
1155261626 18:24049303-24049325 CATAGTGCCTGGCATGTAGTAGG - Intronic
1155887879 18:31229911-31229933 CATTATTCCTAGCATGTAAGTGG + Intergenic
1156069005 18:33182037-33182059 CATTGTGACTTGCAAGAAAAAGG + Intronic
1156971136 18:43158014-43158036 CATTGTGATGAGCATTAAATGGG + Intergenic
1157546164 18:48548020-48548042 CATTGTGCCTGGCATTTAACAGG - Intronic
926029393 2:9572512-9572534 CCCTGTGCCTAGCACGTAATAGG - Intergenic
926064947 2:9831143-9831165 CCTTGTGATTAGCATTTAATAGG + Intergenic
926146978 2:10402312-10402334 CATTGTGGCCTGCATGTAAGGGG + Intronic
927433676 2:23048538-23048560 CATTGTGCCTAGCACACAATAGG - Intergenic
927666985 2:25039617-25039639 CACAGTGTCTAGCATGTCATAGG + Intergenic
928621252 2:33090529-33090551 CATTGTGATGAGAATGAAATGGG - Intronic
930510129 2:52334521-52334543 CATTATAATTAGCATATAATGGG - Intergenic
931398849 2:61912219-61912241 TATTGTGTCTGGCATGTAGTAGG + Intronic
932559689 2:72856167-72856189 CACAGTGACCAGCATGTAGTAGG + Intergenic
933500879 2:83109654-83109676 CCCTGTGCCTTGCATGTAATAGG + Intergenic
933874363 2:86603774-86603796 CATTGTGACTAACATTAAAAAGG + Exonic
936283776 2:111165133-111165155 CATTTCGACGAGCATGTTATTGG + Exonic
940712094 2:157174884-157174906 CATAGTTCCTAGCATGTAGTAGG + Intergenic
940843994 2:158619979-158620001 CATAGGGCCTGGCATGTAATAGG + Intronic
941717291 2:168777339-168777361 CATAGAGTCTGGCATGTAATAGG + Intergenic
944571143 2:201044836-201044858 CTTGGTACCTAGCATGTAATTGG - Intronic
944572316 2:201056947-201056969 CATTGCTATTGGCATGTAATAGG - Intronic
945791826 2:214315035-214315057 AATTGTGACTAGGATGTGATGGG - Intronic
947333844 2:229059400-229059422 CCTTGTGCCTAGCACATAATAGG - Intronic
948354540 2:237367589-237367611 CATTGTGACAAGAATTCAATAGG + Intronic
1170372293 20:15662413-15662435 CATTGTGACTGGCACATAGTAGG + Intronic
1173309684 20:41886344-41886366 CATTGTGACTAGCACATAAATGG - Intergenic
1173325075 20:42025795-42025817 CATAGTGCCTGGAATGTAATAGG - Intergenic
1174438454 20:50529023-50529045 CATGGTGCCTTGCATGGAATTGG + Intronic
1174445025 20:50585104-50585126 CATTGTGTCTTACAGGTAATTGG - Intergenic
1175562567 20:59943233-59943255 CCTTGTGAATAGCAGGTAAAGGG - Intronic
1179666047 21:42913298-42913320 CATAGTGCCTAGCATATAGTAGG - Intronic
1182882881 22:33748506-33748528 CATGGTGCCTAGCATGAATTAGG - Intronic
1182996127 22:34814060-34814082 CATTATGAGTAGCATGTATACGG + Intergenic
1183375467 22:37462271-37462293 CACTGTAACTGGCATATAATGGG + Intergenic
1183786656 22:40032931-40032953 CATGGTGACTGGCATATAGTAGG - Exonic
1183874354 22:40766226-40766248 AATTGTGACTAGCATTTAGTGGG + Intergenic
1184517354 22:44970859-44970881 CATTCTGACTAGCAGAAAATGGG + Intronic
1184997857 22:48223543-48223565 GATTGAGACTACCTTGTAATAGG - Intergenic
950932888 3:16808883-16808905 GAGTGTTACTGGCATGTAATGGG - Intronic
951919919 3:27843128-27843150 CATTGTGCCTAGCATGGAGTAGG + Intergenic
952081587 3:29764852-29764874 CATTGTGAATAGCAGGAACTTGG + Intronic
952214666 3:31266009-31266031 TAATGTGCCTAGCATGTAGTAGG - Intergenic
952587492 3:34910253-34910275 CATTTTGATTAGCATTTGATTGG + Intergenic
955550530 3:60080096-60080118 CATTTTGACTGTCAAGTAATGGG - Intronic
957708598 3:83822932-83822954 CATCATGAATAGCTTGTAATAGG + Intergenic
958716458 3:97788627-97788649 CATAGTGCCTGGTATGTAATAGG + Intronic
959378587 3:105614681-105614703 CAATGTGTCTAGGAAGTAATAGG - Intergenic
959557714 3:107741010-107741032 CTTTGTGTCTGGCATGTCATAGG + Intronic
963877644 3:150494464-150494486 CATTGTAACTAGAAAGTAATGGG - Intergenic
964631320 3:158813478-158813500 AACAGTGACTGGCATGTAATAGG + Intronic
967007535 3:185398672-185398694 CATGGTGCCTAGCATGTAGCAGG + Intronic
969851623 4:9962019-9962041 CATTCTGACTGGCATGAGATTGG - Intronic
969929302 4:10614531-10614553 CACTTTGACTAGCAAGAAATGGG - Intronic
970492587 4:16589993-16590015 AATTGTGCCTGGCATGTAGTAGG + Intronic
971842847 4:31876632-31876654 AACAGTGACGAGCATGTAATAGG - Intergenic
973092215 4:46151432-46151454 GAGTGTGAGTAGCATATAATAGG - Intergenic
973232139 4:47853173-47853195 CATGGTGTTTAGCATGTTATAGG - Intronic
973291049 4:48471085-48471107 CATTGTGCCTATCCTGAAATAGG - Intergenic
973740809 4:53917535-53917557 AATGGTGCCTAGCATGTAGTAGG + Intronic
973756313 4:54077614-54077636 CATAGTCACTAGCCTGTAAGAGG + Intronic
973777556 4:54257135-54257157 CATTATAATTAGCATATAATGGG - Intronic
975063110 4:70028216-70028238 CACTGGGATTAGCATGTGATGGG + Intergenic
975065016 4:70050216-70050238 CACTGGGATTAGCATGTGATGGG + Intergenic
978811424 4:112853935-112853957 CATTATTCCTAGCATGTAGTTGG - Intronic
979493740 4:121360958-121360980 CATAGTGCCTAGCATGTGTTAGG + Intronic
981635879 4:146878376-146878398 CATTTTGACTAGCACCTAATAGG - Intronic
982731872 4:158964571-158964593 CATTCGGACTAGCATGCAAGGGG + Intronic
982946249 4:161628185-161628207 CACTGTGTCTGGCATGTGATAGG + Intronic
983434592 4:167696425-167696447 CGAAGTGACTGGCATGTAATAGG - Intergenic
983884334 4:172963524-172963546 CATAGTGTCTAGCATATAGTAGG + Intronic
984212232 4:176864024-176864046 CAATGTGACTGGCATCTAACTGG - Intergenic
984562443 4:181286605-181286627 CATAGTGAATGGCATGCAATAGG + Intergenic
985392176 4:189501354-189501376 CTTTGTGAGTAATATGTAATTGG - Intergenic
986965945 5:13271251-13271273 AATAGTGCCTAGCATGTAGTAGG + Intergenic
987858189 5:23448590-23448612 CATTATAATTAGCATATAATGGG + Intergenic
988811660 5:34791433-34791455 CATTGTGGCTAAAATGTAATGGG - Intronic
989786534 5:45338740-45338762 CACTGTGACTTGAATGTAGTAGG + Intronic
990996825 5:61740856-61740878 CATGGTCACAAGCATGGAATTGG + Intronic
991467154 5:66925705-66925727 CACTGTGCCTAGCATGTAACAGG + Intronic
993151209 5:84164701-84164723 AATTGTGATTTGCATGTAGTAGG - Intronic
995049132 5:107682544-107682566 CATTGTGCACAGCATGTAGTAGG + Intergenic
995129068 5:108610730-108610752 TCTTGTAAATAGCATGTAATTGG - Intergenic
995312864 5:110733125-110733147 CATTCTGACTGGCATGAGATGGG - Intronic
996026598 5:118653328-118653350 CAATGTAAATAGCAGGTAATGGG - Intergenic
996798385 5:127375775-127375797 CATTGTGCCTGGCATGTGGTTGG + Intronic
998563083 5:143189883-143189905 AACTGTGCCTAGCATGTACTAGG + Intronic
999097076 5:148989225-148989247 CATGGTGGCTGGAATGTAATAGG - Intronic
999837531 5:155390681-155390703 CATAGTGACTAGCACATAGTAGG + Intergenic
1000692275 5:164338410-164338432 CAGTGTGACTAGCATTTAGTAGG + Intergenic
1000897091 5:166868450-166868472 CCTAGTGCCTAGCATGTATTTGG - Intergenic
1001242286 5:170079920-170079942 CATTTAGACTATCATGTAAATGG - Intronic
1001590942 5:172864766-172864788 CACTGTGCCCAGCATATAATAGG - Intronic
1002113280 5:176936200-176936222 CATTGTGACTAGCATGTAATAGG - Intronic
1003528439 6:6917751-6917773 CATTGTGTCTGGCATTTAATAGG - Intergenic
1003722577 6:8720485-8720507 CATTGTGCCTGGCATGTAACGGG + Intergenic
1005084581 6:21991942-21991964 CACAGTGCCTGGCATGTAATTGG + Intergenic
1005983394 6:30854677-30854699 CATTATAATTAGCATGTAATGGG + Intergenic
1007462417 6:42028121-42028143 CACTGTGCCTAGCATGTGGTAGG + Intronic
1008589318 6:52977242-52977264 CAGTCTGCCTGGCATGTAATAGG + Intergenic
1009490637 6:64285744-64285766 TATTGTCACCACCATGTAATGGG - Intronic
1012261160 6:97089298-97089320 CACTATGCCTAGCATGTAACAGG - Intronic
1012369967 6:98491848-98491870 CATAATGTCTAGCATGAAATTGG + Intergenic
1012506199 6:99949171-99949193 CATTATGCCTGCCATGTAATTGG - Intronic
1012520823 6:100119067-100119089 CAATGTTCCTAGCATGTACTAGG + Intergenic
1013508177 6:110819897-110819919 CATTATAACTAACATATAATGGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017671108 6:156770413-156770435 CAATGTGACTGGCATGTCCTGGG - Intergenic
1017786159 6:157758758-157758780 TGTAGTGACTAGCAGGTAATGGG + Intronic
1022732131 7:33037168-33037190 CATTGTGTCTAGCACAAAATAGG + Intronic
1022834395 7:34100096-34100118 CACAGTGCCTAGCATTTAATAGG - Intronic
1023302260 7:38785629-38785651 CCTTGTGATTAGCAGGTCATTGG - Intronic
1026437184 7:70409605-70409627 CATCTTGACCAGCATTTAATGGG + Intronic
1028205374 7:88010704-88010726 CATTGTGATTGGCATGTGGTGGG + Intronic
1028421928 7:90642666-90642688 CACTGTGCCTAGCATGAATTGGG + Intronic
1030882080 7:114892682-114892704 CATTCTGACTTGCATGAGATGGG + Intergenic
1031414521 7:121479521-121479543 CCTTGTAACTAGGATGCAATGGG - Intergenic
1032073860 7:128826924-128826946 CATGGTGCCTGGCATCTAATAGG - Intergenic
1032624847 7:133580882-133580904 CATTGTGCCTGGCAAGTCATAGG + Intronic
1039162233 8:34635122-34635144 CATTGTAACTAACATGGAGTTGG - Intergenic
1039410538 8:37351643-37351665 TATTGGGACTGCCATGTAATAGG + Intergenic
1039889458 8:41674244-41674266 CACAGTGCCTGGCATGTAATCGG - Intronic
1039928925 8:41965043-41965065 CAGTGTGACTTGCATGTAGTAGG - Intronic
1042945325 8:74148390-74148412 CATAGTGCCTGGCATGTAGTAGG + Intergenic
1043464798 8:80494014-80494036 CATTGCCACTAGCATGTATTTGG + Intronic
1044422422 8:92012859-92012881 CATTATAACTTGCATATAATAGG - Intronic
1046715996 8:117567910-117567932 CATTGTGAATAGCATGTTCGTGG - Intergenic
1046969745 8:120208950-120208972 CATAGTGACTTGCATGTAATAGG - Intronic
1055629278 9:78206697-78206719 CATTCTAACTGGCATGAAATGGG - Intergenic
1057269573 9:93643154-93643176 CATTGGGACTAGTATGTCCTTGG + Intronic
1059171297 9:112127616-112127638 TATAATGACTAGCATGTAATAGG - Intronic
1059358263 9:113718238-113718260 CATGTTGGCTAGGATGTAATGGG + Intergenic
1059692083 9:116695319-116695341 CATAGTAACTAGCATATAATAGG + Intronic
1060008173 9:120018846-120018868 CATACTGTTTAGCATGTAATAGG + Intergenic
1060390684 9:123274139-123274161 CCTAGGAACTAGCATGTAATAGG - Intergenic
1062266125 9:135687323-135687345 CGCTGTGACCAGCATGTGATGGG + Intergenic
1186917106 X:14234591-14234613 CTTAGTGCCTGGCATGTAATAGG - Intergenic
1187283517 X:17881181-17881203 TAGTGTGACTAGCATGTACGAGG - Intergenic
1187414143 X:19077617-19077639 CCTTGTAAATAGCATATAATTGG - Intronic
1187830729 X:23378759-23378781 AATTGTGCCTGGCATGTAGTAGG + Intronic
1188140342 X:26542757-26542779 CATTATGAGAAGAATGTAATTGG - Intergenic
1189337309 X:40177670-40177692 CATTGTGGCTGGCATATAGTAGG + Intergenic
1189671776 X:43418281-43418303 CATTGTGCTTAGCATGAAACAGG - Intergenic
1190722051 X:53157189-53157211 CATTATTAATAGAATGTAATGGG - Intergenic
1191012554 X:55775792-55775814 CATAGTGCCTAGCAAGTAGTAGG + Intergenic
1193440877 X:81538048-81538070 CATTGTGACTAGGATCTCAGAGG + Intergenic
1194490200 X:94536369-94536391 CATTCTGACTGGCATGAGATGGG - Intergenic
1195998891 X:110760109-110760131 CATTGTGTCTTTCATGTTATTGG - Intronic
1197907663 X:131443500-131443522 TCCTGTGACTAGCATGTAAGTGG - Intergenic
1198085235 X:133276530-133276552 CATGGTGCCTAGCATATAGTTGG + Intergenic
1199267258 X:145843214-145843236 CCCTGTGACTTGTATGTAATCGG - Intergenic
1199373979 X:147085457-147085479 TTTTGTGGCTAGCATGTAACAGG + Intergenic
1199940802 X:152625860-152625882 CAGTGTGACTAGAAAGTAAAGGG + Intergenic
1202171992 Y:22059815-22059837 CATGGTGCCTAGCATGGCATTGG - Intergenic
1202219370 Y:22526555-22526577 CATGGTGCCTAGCATGGCATTGG + Intergenic
1202323810 Y:23669508-23669530 CATGGTGCCTAGCATGGCATTGG - Intergenic
1202546961 Y:26000546-26000568 CATGGTGCCTAGCATGGCATTGG + Intergenic