ID: 1002114558

View in Genome Browser
Species Human (GRCh38)
Location 5:176948739-176948761
Sequence ATTCAAAACATGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002114554_1002114558 12 Left 1002114554 5:176948704-176948726 CCTAGTGAATGAGTAAAGTGATT 0: 1
1: 0
2: 2
3: 24
4: 184
Right 1002114558 5:176948739-176948761 ATTCAAAACATGGTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002114558 Original CRISPR ATTCAAAACATGGTGGAGCT GGG Intronic
No off target data available for this crispr