ID: 1002123358

View in Genome Browser
Species Human (GRCh38)
Location 5:177022810-177022832
Sequence GTTGCTGGAGGGCCAGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 519}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002123352_1002123358 -1 Left 1002123352 5:177022788-177022810 CCGGGCCTTACAGCAGCTCGGAG 0: 1
1: 0
2: 0
3: 7
4: 163
Right 1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG 0: 1
1: 0
2: 5
3: 52
4: 519
1002123345_1002123358 29 Left 1002123345 5:177022758-177022780 CCACGGTGCAGGCCGCGGACGGC 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG 0: 1
1: 0
2: 5
3: 52
4: 519
1002123353_1002123358 -6 Left 1002123353 5:177022793-177022815 CCTTACAGCAGCTCGGAGTTGCT 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG 0: 1
1: 0
2: 5
3: 52
4: 519
1002123349_1002123358 17 Left 1002123349 5:177022770-177022792 CCGCGGACGGCGGAGCGGCCGGG 0: 1
1: 0
2: 1
3: 12
4: 190
Right 1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG 0: 1
1: 0
2: 5
3: 52
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002123358 Original CRISPR GTTGCTGGAGGGCCAGGAGC CGG Exonic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900225037 1:1529017-1529039 GTGGCTGCAGGGCCTGGAGATGG - Intronic
900389833 1:2429057-2429079 GAGGCTGGAGGGCCAGGGCCTGG + Intronic
900507896 1:3038793-3038815 GTTGCGGCAGGGGCAGGGGCTGG + Intergenic
900788682 1:4665804-4665826 GTTCCTGTAGGACCAGGAGAGGG - Intronic
901012644 1:6210179-6210201 GTTTCCAGGGGGCCAGGAGCAGG - Intronic
901218084 1:7565820-7565842 GAAGCTGGAGGGCCAAGATCAGG + Intronic
901447354 1:9316539-9316561 GGTGCTGGATGGCGAGGAGGGGG + Intronic
901475297 1:9485296-9485318 GCTACTGGAGGGCCAGGCGTGGG + Intergenic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901691088 1:10973839-10973861 CTTGGGGGAGGGCTAGGAGCAGG + Intronic
902230626 1:15025141-15025163 GTTCCTGGAGGGCAGGGACCTGG - Intronic
902810644 1:18886053-18886075 GTGGCTGGGGGTCCAGGAACTGG - Intronic
903029124 1:20450263-20450285 GGTGCAGGAGGGGCAGGAGGGGG + Intergenic
903299482 1:22368544-22368566 GATGCTGGCAGCCCAGGAGCTGG + Intergenic
903469477 1:23575800-23575822 GGTGGGGGAGGGTCAGGAGCAGG + Intergenic
903786718 1:25866132-25866154 GTTGGGGGAGGGCCTGGAGAGGG - Intronic
903968876 1:27106328-27106350 GTGGCTGGAGGGCTGGGGGCAGG + Intronic
904966914 1:34381297-34381319 GGTGCTGGAGGGGAAGGAGGAGG - Intergenic
905033125 1:34900765-34900787 GATTGTGGAGGGCCAGGAGCAGG + Intronic
905346869 1:37317395-37317417 GTTGCTACAGTGGCAGGAGCAGG + Intergenic
905463867 1:38138583-38138605 GTCTTTGGAGGGCCAAGAGCAGG + Intergenic
905527712 1:38651740-38651762 GTTGATGAAGGGGCAGGTGCTGG + Intergenic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906153161 1:43599540-43599562 TTCCCTGCAGGGCCAGGAGCAGG - Intronic
906208386 1:43999004-43999026 GTGGCTGGAGGCTCAGGAGGAGG - Intronic
906316726 1:44791293-44791315 GATGCCTGAGGCCCAGGAGCTGG - Intergenic
906318797 1:44804289-44804311 GTGGCTGGGAGGCCAGGAGCAGG + Intronic
906723674 1:48027857-48027879 GTTGCTGGGGGCCAGGGAGCAGG - Intergenic
906778835 1:48554145-48554167 TTTGCTGGAGGGACAGGACATGG + Intronic
906926720 1:50125651-50125673 GTTCCAGGAGGGTCAGGAGGAGG + Intronic
907012712 1:50978163-50978185 GCTGCCTGAGGGCCAGGACCGGG - Intergenic
907515950 1:54993615-54993637 GGTGCAGCAGGGCCAGGGGCAGG - Intergenic
911564896 1:99452435-99452457 GTTGCTGGAGGGCCTTGATAAGG - Intergenic
911850385 1:102811195-102811217 GTTCCTGGATGGTGAGGAGCTGG + Intergenic
912448023 1:109752091-109752113 GGGGCTGGAGGGCCTGGAGTTGG + Exonic
912800753 1:112718683-112718705 GGTGCTGGGGGGAAAGGAGCTGG - Intergenic
914950749 1:152111299-152111321 GCTGCTGAAGAGCGAGGAGCAGG - Exonic
915142587 1:153776519-153776541 GTTTCTGGAGTCCCTGGAGCCGG + Exonic
915684237 1:157615582-157615604 CTTGCTGGTGGGCAAGAAGCAGG - Intergenic
915936740 1:160094067-160094089 GGTGCATGAGGGGCAGGAGCTGG - Exonic
917440759 1:175066985-175067007 GCTGCTGGAGGGAAAGGAGAAGG - Intergenic
918384862 1:183995465-183995487 GTGGCTGGAGGGAGAGGAACAGG + Intronic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
919981222 1:202643842-202643864 GTTGCAGGAGTGCACGGAGCTGG - Intronic
920269452 1:204752216-204752238 CTTCCGGGAGGGCCAGGAGCAGG + Intergenic
920316182 1:205077077-205077099 GTGACTGGAGGGGCAGGAGATGG + Exonic
921581969 1:216905635-216905657 GTAGCTTCAGGGTCAGGAGCAGG + Intronic
922346275 1:224699364-224699386 GCTGCCGAAGGGCCAGGAGAAGG - Intronic
922385243 1:225075013-225075035 TTTGCTGGAAAGCCTGGAGCTGG + Intronic
922850749 1:228731751-228731773 GTTGCTGGAAGTCCTGGAGGAGG + Intergenic
922861207 1:228818340-228818362 CTTGCGGGAGGGCTGGGAGCGGG + Intergenic
923250495 1:232175995-232176017 GATGCTGGATGCCCGGGAGCAGG - Intergenic
923950111 1:238940796-238940818 GGGGCTGGAGGGCCTGGAGTAGG + Intergenic
924469433 1:244327414-244327436 GTTGCTTGAGGGTCAGAAGAAGG - Intergenic
924560680 1:245154864-245154886 GTTGCGCGAGGGCCGGGAGAGGG - Intergenic
924842732 1:247730760-247730782 GATGTTGGAGGGCCAGGAGAAGG + Intergenic
1062903938 10:1166950-1166972 GTGGCTGGAGGGCCAGTCCCAGG - Intergenic
1062989207 10:1799969-1799991 GGTGCTGGAGGGCCAGGGACAGG + Intergenic
1063104216 10:2978849-2978871 GTTGATTGAGGCCCAGGAGTTGG + Intergenic
1063947313 10:11190868-11190890 GTTGGTGGTTGGCCAGGGGCTGG + Intronic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064161885 10:12953632-12953654 CTTGCTGGGGGACCACGAGCTGG + Intronic
1064188149 10:13181521-13181543 GTTGGTGGAGGGCAGGGAGGGGG + Intronic
1064353583 10:14598887-14598909 CTTGCTGGAGGTCAAAGAGCTGG + Intronic
1064720873 10:18227308-18227330 GTTGCTGGATGGCCAGGGGGAGG + Intronic
1065782389 10:29182170-29182192 GTAACTGGAGGGCGAGGAGGAGG - Intergenic
1067110461 10:43396719-43396741 GCTGCTGGAGTGCCGTGAGCAGG - Exonic
1067167239 10:43875041-43875063 GTTTATGGAGGTCCAGGATCTGG - Intergenic
1067842442 10:49691749-49691771 CCTGCAGGAGGGCCAGGGGCAGG + Intronic
1068940997 10:62681228-62681250 GTTGCTGCTGGGCCACCAGCAGG - Intergenic
1069778338 10:70939624-70939646 GCTGCTGGAGGCACAGGGGCAGG + Intergenic
1070162403 10:73874201-73874223 GTTGCTGCAGGGCGCGGAGGGGG + Intronic
1070180787 10:74011462-74011484 GTTTCTGAAGGGCAAGGAGTGGG + Intronic
1070670748 10:78375657-78375679 GGCGCTGGAGGGACGGGAGCAGG + Intergenic
1070812515 10:79305542-79305564 TCTGCTGGAGGGCCTGGAGGTGG + Exonic
1071060265 10:81561889-81561911 GTTGATAGAGGGAGAGGAGCAGG - Intergenic
1071251457 10:83823815-83823837 GTTGATGGTTGGCCAGGAGGTGG - Intergenic
1074280679 10:112048694-112048716 GTAGCTGGAGGGCAAAGAGCAGG + Intergenic
1074280974 10:112051198-112051220 GATCCTTGAGGGCCAGGAGAAGG - Intergenic
1075605871 10:123807469-123807491 GTAGCTGCAGGGAGAGGAGCAGG - Intronic
1075664095 10:124218576-124218598 AATGCCGGAGGGCCAGGGGCAGG + Intergenic
1076451440 10:130559741-130559763 TGTCCTGGAGGGGCAGGAGCAGG + Intergenic
1076671054 10:132121289-132121311 CTTGCTGGAGCCCCATGAGCTGG - Intronic
1076718883 10:132384018-132384040 GCTGCTGGAGGCCCTGGGGCAGG - Intergenic
1076885583 10:133261027-133261049 GCTACTGGAGGACAAGGAGCAGG - Intergenic
1077484747 11:2833545-2833567 GTTGCTGGCGGGGCAGCAGTGGG - Intronic
1078050301 11:7960099-7960121 GCTGCTGGAGGTAAAGGAGCAGG - Exonic
1078059102 11:8032005-8032027 GGGGCTGGAGGGGCAGCAGCTGG + Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1079090338 11:17476353-17476375 GCTTCTGCAGGGCCAAGAGCTGG - Intronic
1082195810 11:49303839-49303861 GTTTCTGGAGTGTTAGGAGCCGG + Intergenic
1082278604 11:50246840-50246862 CTTGCTGGAGGGGCAGGGCCTGG - Intergenic
1082790724 11:57345138-57345160 GAAGCTGCAGAGCCAGGAGCTGG - Intronic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG + Intronic
1083800139 11:65041748-65041770 GCTGCTGCAGGCCCAGGTGCAGG + Exonic
1084088569 11:66865879-66865901 GGAGCTGGAGGGTCAGGGGCTGG + Intronic
1084213227 11:67633466-67633488 GTCGCTGGACGGTTAGGAGCAGG - Intronic
1084393016 11:68890888-68890910 GAGGCAGAAGGGCCAGGAGCAGG + Intergenic
1084664758 11:70570442-70570464 CTTGCTGCAGGACCAGGACCGGG + Intronic
1085300046 11:75452637-75452659 GCTGCTGGAGGGACAGAGGCTGG + Intronic
1085304620 11:75477998-75478020 GTGGCTGGAGGGGAAGGAGTAGG - Intronic
1085391291 11:76183611-76183633 CTTTCTGGCTGGCCAGGAGCTGG - Intergenic
1085741529 11:79081745-79081767 TTTGCTGGTGGGGCAGGGGCAGG + Intronic
1089008640 11:115114136-115114158 CTTGGTGCAGGGCCAAGAGCAGG + Intergenic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1089287278 11:117415705-117415727 GCTGCTGGAGGGCCAAGACAAGG + Intergenic
1089385184 11:118062637-118062659 GTGGAGGGAGGGCCAGGAGAGGG - Intergenic
1089951714 11:122534395-122534417 GTTGCTAGTGGCCCAAGAGCAGG - Intergenic
1090491686 11:127168705-127168727 GTTGCTGGAGAGCCTGGGGTGGG + Intergenic
1090777667 11:129979564-129979586 GTTGCTGGGGAGACAGGAACTGG - Intronic
1090869918 11:130735141-130735163 GTGGCTGGAGTGGCAGGAACTGG + Intergenic
1091201496 11:133784231-133784253 GTTGGGGGAGGGCAAGGGGCAGG + Intergenic
1091751804 12:3026981-3027003 GTTGGGGGAGGGTTAGGAGCAGG - Intronic
1092262570 12:6960343-6960365 GTCGCAGAAGGGCCAGGAGTCGG + Exonic
1093935255 12:24993942-24993964 GCAGATGGAGGGCCAGGAGGAGG - Exonic
1094494562 12:30981257-30981279 GCTGCTGGAGGGCCGGGTGCTGG - Intronic
1095727406 12:45469122-45469144 CTTGGGGGAGGGCCGGGAGCAGG + Intergenic
1096240133 12:49955497-49955519 AGTGCTGAAGGGCCTGGAGCCGG + Exonic
1096243832 12:49973592-49973614 GCACCTGGAGGGCCAGGAGGCGG + Intronic
1096595383 12:52691871-52691893 GTGGAGGGAGGGCCAGGAGGTGG - Intronic
1097191055 12:57219852-57219874 GGAGCTGGAGACCCAGGAGCGGG + Intronic
1098255475 12:68611199-68611221 GTGGCGCGAGGGCCAGGCGCCGG + Intronic
1098522521 12:71449558-71449580 TTTCCTGGAAGGCCAGCAGCTGG - Intronic
1101095103 12:101330333-101330355 GTGGCTAGAGCACCAGGAGCAGG + Intronic
1101180462 12:102211290-102211312 ATTGCTTCAGGGCCAGGTGCAGG + Intergenic
1102143702 12:110637961-110637983 GTTACTGGAAGGCTTGGAGCAGG + Intronic
1103841646 12:123869986-123870008 GTTGTTCGAGGGCCAGGTGGGGG - Intronic
1104709388 12:130974819-130974841 GTGGAGGGAGGGCCGGGAGCGGG - Intronic
1104900839 12:132188844-132188866 GTTGGGGGAGGGAGAGGAGCAGG + Intergenic
1104969693 12:132525630-132525652 GGTGCTGGGGTGCCGGGAGCAGG + Intronic
1105003061 12:132703589-132703611 CTCTCTGGAGGGCCAGGGGCTGG + Intronic
1105296209 13:19089802-19089824 CTTGCTGGAGCAACAGGAGCTGG + Intergenic
1105806506 13:23954602-23954624 GTGGCTGGAGTGGTAGGAGCAGG + Intergenic
1105857340 13:24385443-24385465 ATAGATGGAGGGACAGGAGCAGG - Intergenic
1106140557 13:27007335-27007357 CTCTCTGGAGGGCGAGGAGCTGG + Intergenic
1108063558 13:46554643-46554665 GTAGTTGGAGTTCCAGGAGCGGG + Intronic
1110326201 13:74218482-74218504 GGTGCTGGAGGGTGCGGAGCGGG - Intergenic
1111390521 13:87588670-87588692 GGGGCTGGAGGGCTAGGAGAGGG + Intergenic
1111669903 13:91317523-91317545 GTTGCTGGAGGTGAAGGAGAAGG - Intergenic
1112049805 13:95634094-95634116 GTGGCTGGAGTGGCAGGGGCAGG - Intronic
1112293212 13:98163326-98163348 GTGGCAGGAGGGGGAGGAGCAGG + Intronic
1112570131 13:100586655-100586677 CTCACTGGAGGGCCAGGAGAAGG - Intronic
1113442675 13:110341315-110341337 GGGGCTGGACGGCCAGCAGCTGG - Intronic
1114670790 14:24409930-24409952 CTTACTGAAGGGCCAGGGGCAGG + Exonic
1116257134 14:42571005-42571027 CTTGGGGGAGGGCCAGGAGCAGG + Intergenic
1117313461 14:54551178-54551200 GGTGCTGCTGGGCCTGGAGCTGG - Intergenic
1118790901 14:69091793-69091815 GTCGCCTCAGGGCCAGGAGCTGG + Exonic
1119387406 14:74266231-74266253 GAGGCTGGAGGGCCAGCAGGAGG - Intergenic
1120818831 14:88893018-88893040 GTGGCTGGAGGGATAGCAGCAGG - Intergenic
1121245747 14:92459858-92459880 GTGGTGGCAGGGCCAGGAGCTGG - Intronic
1121310415 14:92932629-92932651 GCGGCTGGAGGGGCAGGAGGAGG + Exonic
1121553475 14:94819538-94819560 TTTGGGGGAGGACCAGGAGCAGG - Intergenic
1121674207 14:95739360-95739382 GGTGCTGGGGGGCCAGGGGTAGG - Intergenic
1122098110 14:99386370-99386392 ATGGCTTGAGGGCCAGGAGCAGG - Intergenic
1122946015 14:105009890-105009912 GTTGCTGGAGGGTCAGGCCGTGG + Exonic
1202904041 14_GL000194v1_random:58453-58475 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1123473362 15:20570681-20570703 GTTGCAGGAGGCCCAGGGGAGGG + Intergenic
1123644646 15:22429672-22429694 GTTGCAGGAGGCCCAGGGGAGGG - Intergenic
1123733662 15:23165692-23165714 GTTGCAGGAGGCCCAGGGGAGGG + Intergenic
1123751791 15:23363067-23363089 GTTGCAGGAGGCCCAGGGGAGGG + Intronic
1124496914 15:30192572-30192594 GTTGCAGGAGTGCACGGAGCTGG - Intergenic
1124746662 15:32346075-32346097 GTTGCAGGAGTGCATGGAGCTGG + Intergenic
1124940502 15:34213224-34213246 GATGCTGGATGGCCAGGGGTAGG + Intergenic
1125165737 15:36702503-36702525 GGTGAGGGAGGGCCAGGAGCAGG - Intronic
1125609248 15:40959752-40959774 GCTCCTGGAGAGCCAGGAGTCGG + Intergenic
1125775427 15:42208264-42208286 GTTGTTGAAGGGCCTGTAGCCGG - Exonic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1127918722 15:63476520-63476542 GCAGCTGGAAGACCAGGAGCAGG + Intergenic
1128213257 15:65916798-65916820 GTGGCTGGGAGGCCAGGAGGTGG + Intronic
1128360156 15:66956301-66956323 GTTGAGGGAGGGGCAGGAACAGG - Intergenic
1128684269 15:69672025-69672047 CTGGCTGGAGGGGCAGCAGCAGG + Intergenic
1128740559 15:70080856-70080878 GGTGCTGCAAGCCCAGGAGCAGG - Intronic
1128779765 15:70351679-70351701 GTGGCTGGAGGGCAGTGAGCAGG - Intergenic
1128898468 15:71397339-71397361 GTTGCAGGAGGTCAAGGACCTGG + Intronic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129704198 15:77785253-77785275 GCTGCTTGAGGGCCAAGAGAGGG - Intronic
1129774191 15:78223938-78223960 AATGCTGGAGCACCAGGAGCTGG + Intronic
1129921365 15:79322046-79322068 GCTGCGGGAGGCCCAGGACCGGG + Exonic
1130688969 15:86063887-86063909 GTTGCTGGAGGGTGGGGGGCGGG + Intergenic
1130707415 15:86246346-86246368 GTTGCTGGGGAGCCTGGAGGTGG + Intronic
1132117872 15:99150841-99150863 GTTGCTGGTGGGAGAGGTGCAGG - Intronic
1132596557 16:753654-753676 GTAGCAGGAGGGCGAGAAGCAGG - Intronic
1132616224 16:842281-842303 GTTGCTGCAGGCCCAGGAGACGG - Intergenic
1133036175 16:3035573-3035595 ATTCCTGGAGGGCCAGGTGCTGG - Intronic
1133809259 16:9148622-9148644 GTTCCTAAAGGGCCAGGAACTGG + Intergenic
1134027899 16:10968395-10968417 ATTTCTGCAGGGCCAGGCGCTGG + Intronic
1135911543 16:26566073-26566095 GTTGAGGGTGGGTCAGGAGCAGG - Intergenic
1136248716 16:28989846-28989868 TCTGCGGGAGGGGCAGGAGCTGG + Intronic
1137237266 16:46626171-46626193 GATGGTGGAGGGCCAGCTGCTGG + Intergenic
1137496812 16:48975902-48975924 GTTGCTGAGGGGCCAGTAGCAGG + Intergenic
1137827830 16:51514954-51514976 TAAGCTGCAGGGCCAGGAGCAGG + Intergenic
1138394714 16:56695306-56695328 GTTCTTGGGGGGCCAGAAGCAGG + Intronic
1139478611 16:67215919-67215941 GTATCAGTAGGGCCAGGAGCTGG - Intronic
1141110584 16:81267900-81267922 CTTGCTAGAGGGCAAGAAGCAGG + Exonic
1141708528 16:85683545-85683567 TTGGCTGGAGGCCCAGGAGAGGG - Intronic
1141948204 16:87324542-87324564 GGTGCTGGAGGGCCAGGGGGAGG - Intronic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1143021093 17:3917551-3917573 CTTGCTGGCGAGCCATGAGCTGG + Intergenic
1143743958 17:8975972-8975994 GAAGCTGGAGGACCTGGAGCAGG + Intergenic
1143770207 17:9163765-9163787 GATGCTGGAGGGTGAGAAGCGGG + Intronic
1144739374 17:17572671-17572693 GCTGCGTGAGGGCCAGGGGCCGG + Intronic
1144762570 17:17715656-17715678 ACTGCTGGAAGGTCAGGAGCGGG - Intronic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1145235309 17:21203758-21203780 GCTGCTGGGTGGTCAGGAGCTGG - Intronic
1145979263 17:29002242-29002264 GAAGCTGGAGGGCCTGGAACTGG + Intronic
1147441194 17:40448210-40448232 GTCTCTCGAGGGCCAGGGGCTGG + Intronic
1147553238 17:41460069-41460091 GATCCTGGAGGGCCTGGGGCTGG - Exonic
1147578015 17:41613648-41613670 GTGGCTGGAGGGGCAGGATGGGG - Intronic
1147670311 17:42173233-42173255 GTTCCTGGAGGCCCAGGAAGGGG - Intronic
1147679018 17:42227615-42227637 GCTCCTGGAGGGCCTGGTGCAGG - Exonic
1147686644 17:42289914-42289936 GCTCCTGGAGGGCCTGGTGCAGG + Exonic
1147945989 17:44080476-44080498 GTTGGTGGAGGACCAGGCGTGGG - Exonic
1148073176 17:44920595-44920617 GTTGGCGGAGGGGCAGGAGCTGG + Intergenic
1148774467 17:50087889-50087911 GCTGGTGGAGGTCCCGGAGCAGG - Intronic
1148791509 17:50175787-50175809 GTTCCAGGAGGGCCAGGAGCTGG - Exonic
1148793187 17:50184980-50185002 GGTGCTGGGCGGGCAGGAGCGGG + Exonic
1149098672 17:52876183-52876205 GTTGTTGCAGGGGCAGGAGGTGG + Intronic
1149260114 17:54871107-54871129 GTTGCTGAAATTCCAGGAGCTGG - Intergenic
1149433713 17:56616255-56616277 TTTGTTGGAAGGCAAGGAGCAGG + Intergenic
1149451620 17:56754268-56754290 GTTACTGGTGGGCCAGGAATAGG - Intergenic
1149499725 17:57143159-57143181 GTGGCTCAAGGGTCAGGAGCAGG - Intergenic
1150505104 17:65690877-65690899 GTTGCTGGGGGGTGGGGAGCAGG + Intronic
1151701017 17:75742601-75742623 GTTCCAGGAGGGCGTGGAGCTGG + Exonic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1151969556 17:77450723-77450745 GAGGCTGGAGAGGCAGGAGCTGG + Intronic
1152109195 17:78347988-78348010 GAGGCCGGAGGGACAGGAGCTGG - Intergenic
1152431735 17:80252045-80252067 GGTACGGGAGGGACAGGAGCAGG + Intronic
1152466925 17:80471731-80471753 GCTGGTGCTGGGCCAGGAGCAGG - Exonic
1152630669 17:81409455-81409477 GGTTCTGGAGGGCCAGGAGCGGG + Intronic
1153582952 18:6593832-6593854 GGTGCTGGGGGGTCAGGAGAAGG + Intergenic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154326556 18:13395538-13395560 GTTGTTGTGGGGGCAGGAGCTGG + Intronic
1156555918 18:38068225-38068247 CTTGCTGGTGGGCCAGGACACGG + Intergenic
1156671199 18:39472033-39472055 TTTGCTGTAGGGCCATGAGGAGG + Intergenic
1157020270 18:43773114-43773136 TTTGCTTGTGGGCCAAGAGCTGG + Intergenic
1157512768 18:48290456-48290478 GTAGCTGCAGTGCCAGGGGCAGG + Intronic
1157565164 18:48674890-48674912 GTGGCTGGAGGGAAAGGAGCAGG + Intronic
1159185551 18:64967698-64967720 GTTGCTGGAGAGAGAAGAGCAGG + Intergenic
1160163358 18:76491634-76491656 GTTGCTGGGCTGCCAGGAGGAGG - Intronic
1160183421 18:76655671-76655693 GGTCCTGGAGGACCAGGAGCAGG - Intergenic
1160443552 18:78911469-78911491 GGAGCTGGAGGGCCTGGGGCTGG - Intergenic
1160443583 18:78911552-78911574 GGAGCTGGAGGGCCTGGGGCTGG - Intergenic
1160443626 18:78911675-78911697 GGAGCTGGAGGGCCTGGGGCTGG - Intergenic
1160443647 18:78911737-78911759 GGAGCTGGAGGGCCTGGGGCAGG - Intergenic
1160500051 18:79396878-79396900 GGTCCTGCAGGTCCAGGAGCCGG - Intronic
1160788167 19:911681-911703 GTTGGTGGAGGGCGAGGAGGCGG - Intronic
1160827185 19:1086046-1086068 CGTGCTGGAGGGACAGGAGCAGG - Exonic
1161104011 19:2434422-2434444 GATGCTGGACGCCAAGGAGCAGG - Exonic
1161116374 19:2499117-2499139 GTTGCTGGAGGACCAGAACAAGG - Intergenic
1161720389 19:5899016-5899038 GGGGCTGCTGGGCCAGGAGCAGG - Intronic
1161771651 19:6234091-6234113 GCTGAAGGATGGCCAGGAGCTGG + Intronic
1162016191 19:7847806-7847828 GTTGGAGGAGGCCGAGGAGCTGG - Exonic
1162397477 19:10425433-10425455 GGTGCTGGGCAGCCAGGAGCTGG + Intronic
1162412221 19:10513375-10513397 GATGCTGGTGTGCCTGGAGCAGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163322198 19:16581399-16581421 GGTGCTGGAGTGCCTGGGGCAGG - Intronic
1163323668 19:16589143-16589165 GGAGCTGGAGGGACAGGAGTGGG + Intronic
1163597981 19:18231534-18231556 GCTGCTGGAGGGCCAGGCTGGGG + Intronic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164391224 19:27822792-27822814 TTTGCTGGAGATCCTGGAGCCGG + Intergenic
1164516806 19:28943698-28943720 GTGGCCGGAGGGCCAGAAGGTGG - Intergenic
1164557956 19:29268209-29268231 GGGGCTTGAGGGACAGGAGCCGG + Intergenic
1164623928 19:29714685-29714707 GTGGCTGGTGGGGCAGGGGCGGG - Intronic
1165084005 19:33330011-33330033 GTTGCTGGAGAGAGAGAAGCAGG - Intergenic
1165471162 19:36005467-36005489 GTTGGGGGAGGGCCAGGATAGGG + Intronic
1166295822 19:41888811-41888833 GCTGCAGGAGGGCCATGAGGTGG - Exonic
1166326050 19:42051824-42051846 GCGGCAGGAGGGGCAGGAGCTGG - Intronic
1166789770 19:45391935-45391957 GGAGCTGGTGGGGCAGGAGCAGG + Exonic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1166966770 19:46533744-46533766 GATCCTGGAGGGCCTGGAGCAGG + Intronic
1167105266 19:47426733-47426755 GTTGCTGGAGGAGCAGTAGAGGG - Intergenic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167425617 19:49428352-49428374 GTACCTGGAGGGGCAGGGGCGGG - Intronic
1167502664 19:49856561-49856583 GATGATGGAGGCCCAGAAGCAGG + Intronic
1168701037 19:58439758-58439780 GTTGCTGATGGGCCCGGCGCAGG - Exonic
925654104 2:6126299-6126321 CTTGCTGGAGAGCCAGGAAGTGG + Intergenic
925922583 2:8647290-8647312 GGTCTTGGAGGGCCAGGAACAGG + Intergenic
926468864 2:13227720-13227742 CTTGCTGGAGGGGGAGCAGCTGG + Intergenic
926681743 2:15669301-15669323 TTGGCTGGAGGGCTGGGAGCAGG - Intergenic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927484050 2:23476966-23476988 GCTACTGAAGGGACAGGAGCTGG + Intronic
927517361 2:23680175-23680197 GGTGCTGGAGGGCCTAGGGCAGG + Intronic
927843958 2:26461915-26461937 GTGGCTGAAGGGCCAGCAGGAGG - Exonic
928166793 2:28977722-28977744 CTGGCTGGTGGGCCAGGAGAGGG + Intronic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
930056735 2:47258007-47258029 GTGGCTGGTGGGCCAGGCACAGG - Intergenic
931121457 2:59224898-59224920 GTTGCAGGAGAGCCTGGAGGGGG + Intergenic
932487824 2:72095318-72095340 TTTGCAGGAGGGCCAGCTGCAGG + Intergenic
932536549 2:72603358-72603380 GGTGCTGGGGGGCCAGGGGAGGG - Intronic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
934664286 2:96158902-96158924 GTCGCGAGAGAGCCAGGAGCTGG + Intergenic
934691934 2:96368180-96368202 GTTGATTGAGGGCCCTGAGCTGG + Intronic
934708223 2:96499506-96499528 TTTGCTGCGGGGCCAGGGGCGGG - Intronic
934884721 2:98014478-98014500 GTGGCTGGTGGGCTAGGGGCTGG - Intergenic
935125420 2:100218399-100218421 CTAGCTGGGGGACCAGGAGCAGG - Intergenic
935173091 2:100625968-100625990 GCTGTTGGAGGGCTTGGAGCAGG + Intergenic
935433424 2:103002740-103002762 CTTGCTGGTGTCCCAGGAGCAGG - Intergenic
935971524 2:108534453-108534475 GCTACTGGCGGGCCCGGAGCAGG - Intronic
937227554 2:120378471-120378493 GTAACTGGAGGGGCAGGAGAAGG + Intergenic
937909645 2:127069193-127069215 GGGGCTGGACGGCCAGGAGGGGG - Intronic
938707317 2:133943737-133943759 GTTCCTGGAGGGCAAGGACTGGG + Intergenic
938795899 2:134718444-134718466 GGCGCCGGAGGGCCTGGAGCTGG + Intronic
939914305 2:148020909-148020931 GTAGCGGGAGGTACAGGAGCGGG - Intronic
940900772 2:159124441-159124463 GTTGCTGTTGGTCCAGGGGCTGG + Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
944766716 2:202871709-202871731 GCTGCCGGAGGGCCGGGAGTCGG - Intronic
946023698 2:216659206-216659228 GCTGCTGGAGTGCCAGCACCCGG + Intronic
946688235 2:222292542-222292564 GTTGCTGGAGGCTCCGGCGCTGG - Intronic
946789484 2:223285581-223285603 CTTGTGGGAGGGCCAAGAGCAGG - Intergenic
947611044 2:231525315-231525337 CGTGCTGGAAGGCCAGGTGCAGG + Exonic
947818073 2:233051407-233051429 GTTGCTGGAAGGGCAAGAGTGGG + Intergenic
948161337 2:235827360-235827382 GTGGCTGAAGGGCTTGGAGCAGG + Intronic
948388993 2:237598633-237598655 GATGCTGGAGGGGACGGAGCAGG - Intronic
949023637 2:241754937-241754959 GTCTCTGGAGGGGCAGGTGCTGG + Intronic
949036367 2:241817302-241817324 GAGGCTGCAGGGCCAGGCGCGGG + Exonic
1168788088 20:557102-557124 TTGGCTGCTGGGCCAGGAGCAGG + Intergenic
1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG + Intergenic
1169109303 20:3021771-3021793 TTGCCTGGAGGGCCAGGGGCAGG - Intronic
1169216288 20:3796488-3796510 CTGGCTGGAGGGCCGGGCGCAGG - Exonic
1171235507 20:23521087-23521109 GGTTCTGAAGAGCCAGGAGCAGG + Intergenic
1171881745 20:30622353-30622375 GGAGCAGGAGGGTCAGGAGCAGG - Intergenic
1172038723 20:32028934-32028956 CCTGCCTGAGGGCCAGGAGCTGG + Intronic
1172224930 20:33299236-33299258 AGTGCTGGAGGGCCAGGGACCGG - Intronic
1172384397 20:34523458-34523480 GTGGCTGAAGGGCAGGGAGCAGG - Intronic
1172555924 20:35841246-35841268 GAGGCTGGAGGGACACGAGCTGG + Intronic
1173870139 20:46336455-46336477 GTGGGAGGAGGGACAGGAGCAGG + Intergenic
1174097533 20:48101250-48101272 GGTGCTGCAGAGCCAGGATCAGG + Intergenic
1175181056 20:57147970-57147992 GTTGCTGGAGGGCAGGCAGGAGG - Intergenic
1175186740 20:57183954-57183976 GTTACAGGAGGGCCACGAGCGGG + Intronic
1175392170 20:58634414-58634436 TCTGCTGGATGGGCAGGAGCCGG - Intergenic
1175416686 20:58805792-58805814 GTTTCTGGAAGGTCAGGAGTGGG - Intergenic
1175465834 20:59191074-59191096 GCCCCTGGAGGGCCAGGAGTGGG - Exonic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176053612 20:63133644-63133666 GTGGGTGAAGGGCCAGGATCTGG - Intergenic
1176099794 20:63359728-63359750 GGTGCAGGCGGGACAGGAGCCGG + Intronic
1176106983 20:63394062-63394084 GTTGGGGGAGGGCCAGGAAGGGG + Intergenic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176623413 21:9073220-9073242 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1178949466 21:36974399-36974421 GTTTCAGGAAGGCCAGGGGCTGG - Intronic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1179936975 21:44612258-44612280 GCAGCTGGAGGCACAGGAGCGGG - Exonic
1179993228 21:44959461-44959483 TTTGCTGGGGGGACAGGGGCAGG - Intronic
1180049968 21:45326604-45326626 GATGCTGTGGGGGCAGGAGCAGG - Intergenic
1180079748 21:45481195-45481217 ATTGCTGGAGGGCCAGGGGAGGG + Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181053238 22:20247439-20247461 AGTGGTGGAGGGCCAGGAGTGGG - Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181147418 22:20858759-20858781 GGCGCTCGCGGGCCAGGAGCGGG - Exonic
1181276228 22:21688816-21688838 GTTGCTGTTGGGCCCGGAGTTGG - Exonic
1182422009 22:30253339-30253361 GGGGCTGGAGGGTGAGGAGCAGG - Intergenic
1182593612 22:31400722-31400744 GGTGGTGGAGGTCCAGGAGAAGG + Exonic
1183101631 22:35587741-35587763 GTGGCTGTAGGGGCAGGAGTGGG + Intergenic
1183385207 22:37510211-37510233 GTTGCAGGAGGGCCTGCAGCAGG - Exonic
1184109258 22:42385408-42385430 GTGGCTGGAGGGCAATGGGCAGG - Intronic
1184358995 22:44002521-44002543 GTTGGTGGAGGGGCAGAGGCGGG + Intronic
1184431394 22:44443301-44443323 GTGGCTGCAGGGTCAGGACCAGG + Intergenic
1184834478 22:47013032-47013054 GAGGCTGGAGGGCCAGATGCAGG - Intronic
1185168457 22:49276778-49276800 TTTCCTGGAGGGCCAGGTGTTGG + Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949518353 3:4827183-4827205 GGTGCTGTCGGGGCAGGAGCAGG - Intronic
949580996 3:5388182-5388204 GTGGCTGGAGAGATAGGAGCTGG + Intergenic
950298220 3:11850382-11850404 GTGGATGAAGGGCCAGGAGCAGG - Intergenic
950923234 3:16716080-16716102 GTGGCTAGAGGCCCAGGACCAGG + Intergenic
951361356 3:21728135-21728157 GGTGGTGGAGGGCTAGGAGAGGG + Intronic
951798307 3:26566710-26566732 CTTAGGGGAGGGCCAGGAGCAGG - Intergenic
952312497 3:32202780-32202802 GCTGCTGGAGGGAGAGCAGCTGG - Intergenic
952760100 3:36905899-36905921 GTGGCAGGAAGGCCAGCAGCAGG + Intronic
952858928 3:37796016-37796038 TATGCTGGAGAGACAGGAGCTGG - Intronic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
954034356 3:47842944-47842966 GCTGCTGCATAGCCAGGAGCAGG - Intronic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
954632583 3:52055453-52055475 GTTTCTGGAAGGCCAGGATCAGG - Intronic
954707606 3:52489397-52489419 GCTGCTGCAGGGGCTGGAGCTGG - Exonic
955677720 3:61466446-61466468 GGTTCTGGACGGCAAGGAGCTGG - Intergenic
956737408 3:72248291-72248313 GATGCTGGAGGGCCAGGCTTGGG - Intergenic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
960687217 3:120306806-120306828 GGGGCTGGCTGGCCAGGAGCGGG - Intergenic
961049388 3:123733854-123733876 GTGGCTGGACGGGGAGGAGCTGG + Exonic
961750385 3:129090863-129090885 GATGGTGGAGGGCCAGCTGCTGG + Exonic
963428088 3:145157665-145157687 GGGGCTGGAGGGCAAGGAGAGGG + Intergenic
968794707 4:2695050-2695072 GTTGGTGGAGGTCGAGGTGCTGG - Exonic
968969859 4:3788164-3788186 GGGGCAGGAGGGGCAGGAGCTGG - Intergenic
969358717 4:6647565-6647587 CATGCTGGAGGCCCAGGAACAGG + Intergenic
970008007 4:11428796-11428818 GTTTCTGGATGGCCCGGGGCAGG + Exonic
970291504 4:14577849-14577871 GTTGGAGGAGGGAGAGGAGCAGG + Intergenic
970353199 4:15226864-15226886 GTTGCTGGAGAATCAGGCGCAGG - Intergenic
970645167 4:18111581-18111603 GCTACTGGAGGGCCTGGAGAAGG - Intergenic
970664307 4:18319337-18319359 GGTGCTGGGGGAGCAGGAGCGGG + Intergenic
975617122 4:76257569-76257591 GTGGTTGGAGTGGCAGGAGCAGG - Intronic
975646169 4:76548199-76548221 GCCGCTGGAAGGCCAGGGGCTGG + Intronic
975897091 4:79106320-79106342 GTTGTTGGCAGGCCTGGAGCTGG + Intergenic
977585774 4:98773901-98773923 GAGGCAGGAGGGCCAGGAGATGG - Intergenic
979378786 4:119983451-119983473 GTTCCTGGAGCTCCAGGAGCAGG - Intergenic
982235621 4:153249025-153249047 GTTGCTGGAGGGCCAGGCGGGGG + Intronic
983831347 4:172331535-172331557 GTGGATAGAGGGACAGGAGCTGG - Intronic
984227509 4:177052783-177052805 GTTTCTGGCAGGCCAGGAACAGG + Intergenic
984947790 4:184983378-184983400 GTGGCTGGAGGGCTTGCAGCTGG - Intergenic
985544936 5:504761-504783 GTCGGTGGCCGGCCAGGAGCTGG - Intronic
985765828 5:1779116-1779138 GTTGCGGGAAGGCAAGGAGGCGG + Intergenic
986215178 5:5712991-5713013 CTTGAGGGAGGGCCGGGAGCAGG - Intergenic
988155268 5:27441726-27441748 TTTGCTGATGGGCCAGCAGCTGG + Intergenic
991598666 5:68330793-68330815 TTGGCTGGAGGGCAAGGAGGTGG - Intergenic
992366086 5:76091404-76091426 GTTGCTGCAGGGACCAGAGCAGG - Intronic
992703908 5:79368627-79368649 CTTGGTGGAGGAGCAGGAGCTGG - Intergenic
992807482 5:80351806-80351828 GACGCTGGAGGGCCGGGAGAAGG - Intergenic
994631811 5:102296367-102296389 GAGGCTGGAGGGCCAGGAGGCGG - Exonic
995682277 5:114733109-114733131 GTTGTTGGAGTGCATGGAGCAGG - Intergenic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
997402262 5:133612192-133612214 CTTGCTGCAGGGCCCGGCGCGGG - Intronic
997835922 5:137193422-137193444 GGTGATGGAGGCCCTGGAGCAGG + Intronic
998138555 5:139687359-139687381 GGTGATTGTGGGCCAGGAGCTGG + Intergenic
998385900 5:141756977-141756999 GGTGCGGGAGTGTCAGGAGCAGG - Intergenic
999232334 5:150069156-150069178 GTTGCTCCAAGGCCAGCAGCTGG + Intronic
1000672630 5:164081086-164081108 GCTATGGGAGGGCCAGGAGCAGG - Intergenic
1001567139 5:172707039-172707061 TTGGCTGGAGGGCGAGGACCAGG + Intergenic
1001628711 5:173158577-173158599 GTTGCTGGGGAACCAGGAGGCGG + Intronic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002336580 5:178483471-178483493 GGTGCTGGAAAGCCAGGAGAAGG - Intronic
1002468973 5:179423345-179423367 CTGACTGGTGGGCCAGGAGCGGG + Intergenic
1003216441 6:4117675-4117697 GTTGTTGGAGGGGCAAGATCAGG + Intronic
1004517343 6:16331502-16331524 GCTGCAGGAGGGCCAGCAGGGGG - Intronic
1005956825 6:30670047-30670069 GTTGCTGGAGGGCAAGGGCAGGG - Intronic
1005994444 6:30922837-30922859 GTGGCTGCAGGGCCAGGACCTGG - Intronic
1006258592 6:32850496-32850518 GTTGCTGGAAGTGCAGGTGCGGG - Exonic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1007564033 6:42834827-42834849 GTTGATGGTAGGGCAGGAGCAGG - Intronic
1012277828 6:97295168-97295190 CTTGCTGGAGGACCAGGAAAAGG - Intergenic
1012930218 6:105308974-105308996 GAGGATGGAGGGCCAGGAGTAGG + Intronic
1012936391 6:105372322-105372344 TTTGCTGGAGGGCTGGGATCTGG - Intronic
1013701113 6:112770624-112770646 ATTGCTGGAGGGCTTGGTGCAGG - Intergenic
1013871611 6:114768992-114769014 GTTGCTGGAGGGTGCAGAGCAGG + Intergenic
1014790111 6:125662914-125662936 ATAGCAGAAGGGCCAGGAGCTGG - Intergenic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1016627679 6:146191288-146191310 GTTCCTTGAGGGCAAGGACCAGG + Intronic
1016999363 6:149985395-149985417 GTTGCTGGAGGAACAGGATGTGG + Intergenic
1017506334 6:155072111-155072133 GTGGCTGGGAGGACAGGAGCTGG + Intronic
1017908356 6:158772096-158772118 GTAGCTGGTGTGGCAGGAGCAGG - Intronic
1017987917 6:159460672-159460694 GTGGCTGGAGCTGCAGGAGCAGG - Intergenic
1018292235 6:162303865-162303887 GGTAGTGGAGGGCCAGGAGGAGG + Intronic
1018612935 6:165661787-165661809 TTCTCTGGAGGGGCAGGAGCCGG - Intronic
1018686489 6:166307987-166308009 CGTGGCGGAGGGCCAGGAGCTGG + Exonic
1019255275 7:45825-45847 CAGGCTGGAGGGCAAGGAGCTGG + Intergenic
1019374806 7:683730-683752 GTGGCAGGTGGGCCAGGAGTGGG - Intronic
1019417243 7:933474-933496 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417254 7:933504-933526 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417270 7:933541-933563 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417301 7:933631-933653 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417312 7:933661-933683 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417323 7:933691-933713 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417354 7:933781-933803 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417395 7:933901-933923 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417416 7:933961-933983 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417427 7:933991-934013 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417455 7:934081-934103 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417466 7:934111-934133 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417487 7:934171-934193 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417498 7:934201-934223 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417526 7:934291-934313 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417536 7:934321-934343 GGTGCTGGAGAACCAGGGGCTGG + Intronic
1019459995 7:1152793-1152815 GGGGCTGGAGGTCCAGGCGCAGG - Intronic
1021890148 7:25179858-25179880 CTTGGGGGAAGGCCAGGAGCCGG + Intronic
1022288171 7:28975183-28975205 GTTCCTGGAGGGGCAGAACCAGG + Intergenic
1022564678 7:31385867-31385889 GTGGCTGGAGGACAAGGAGATGG + Intergenic
1023940260 7:44764950-44764972 TTTGCTGGAGGGCCTGGAGGTGG + Exonic
1024671800 7:51602505-51602527 GTGGCTGTTGGGGCAGGAGCAGG - Intergenic
1024766262 7:52664479-52664501 GTGGCTGGAGTGGCTGGAGCAGG - Intergenic
1025911502 7:65832401-65832423 CTTGAAGGAGGGCAAGGAGCTGG + Intergenic
1025929366 7:65982060-65982082 GTCGCGGGAGTGCAAGGAGCTGG - Exonic
1026286041 7:68963592-68963614 GATCCTGGAGGGCAAGGGGCTGG + Intergenic
1027179519 7:75928509-75928531 ATTGCTGGAGGGCCTGGCCCTGG - Intronic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1029255647 7:99267731-99267753 GATGCTGCAGGGCCAGGAAATGG - Intergenic
1029459490 7:100686895-100686917 GGGGCAGGAGGGCCTGGAGCTGG - Intronic
1029524832 7:101088191-101088213 GGAGCTTGAGGGCCGGGAGCAGG + Exonic
1029595505 7:101535560-101535582 GCTGCTGGAGGCCATGGAGCTGG - Intronic
1029705567 7:102274089-102274111 GCTGCAGGAGGGCCCGGACCTGG - Intronic
1029923198 7:104287840-104287862 GAGGCTGGAGGGTCAGGAGTTGG - Intergenic
1031596870 7:123658973-123658995 GATGCTGCAGGGGCAGGAGTTGG - Intronic
1033050687 7:138001678-138001700 GGTGCTGGAGAGCGGGGAGCAGG - Exonic
1033478857 7:141718488-141718510 GTTGCTAGTTGGCCAGTAGCGGG + Intronic
1034276954 7:149828072-149828094 GCTGCTGCAGGGCCTGGAGTAGG - Intergenic
1034390693 7:150785288-150785310 ATTGCTGGACGGGGAGGAGCTGG - Intergenic
1034400366 7:150857799-150857821 GGGGCTGAAGGGCCAGGTGCTGG + Exonic
1036512949 8:9417547-9417569 GTGGCTGAAGGGCCAGCAGGAGG - Intergenic
1037906814 8:22720330-22720352 TGTGATGGAGGGCCAGCAGCCGG + Intronic
1039648180 8:39310118-39310140 GTTGCTGGATGCTCAGGAGGAGG + Intergenic
1039704116 8:39989768-39989790 GTCGCTGCAGGGCTTGGAGCAGG - Exonic
1039944280 8:42116564-42116586 GATGCTCCAGGGCCAGGTGCAGG - Intergenic
1041070103 8:54119959-54119981 GATGCTGGAAGTCCAGGACCAGG - Intergenic
1041706681 8:60853520-60853542 GCTGCTGCAGGGTCAGGAGAGGG - Intronic
1045674186 8:104589418-104589440 GCTGCTGGATGCCCAGGGGCTGG + Intergenic
1045897261 8:107234385-107234407 GATGCTGGAGGGCTGAGAGCTGG - Intergenic
1045950917 8:107850756-107850778 GTGGTTGGAGGGCAAGCAGCAGG - Intergenic
1046470136 8:114661901-114661923 GATCATGGAGGGCAAGGAGCTGG - Intergenic
1048906396 8:139093279-139093301 GTTGCTGGAGGAACAGGATTTGG + Intergenic
1049229960 8:141476839-141476861 GTTGCTGGAGGACCCGCAGAGGG - Intergenic
1049583434 8:143422732-143422754 GTTGCAGGAGGGGTAGGCGCAGG - Intronic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1050130417 9:2406547-2406569 GTTACTGGGGGGCCAGGAGCAGG + Intergenic
1050393726 9:5173618-5173640 GTTGGGGGAGGGCCAGCATCAGG + Intronic
1053596211 9:39564043-39564065 ATCTGTGGAGGGCCAGGAGCTGG + Intergenic
1053854179 9:42320684-42320706 ATCTGTGGAGGGCCAGGAGCTGG + Intergenic
1054570045 9:66800974-66800996 ATCTGTGGAGGGCCAGGAGCTGG - Intergenic
1055771048 9:79717425-79717447 CTTGCTGGAGGGGAAGGAGGTGG - Intronic
1055788664 9:79898409-79898431 GTTGCTGTAGGGCAGGAAGCTGG - Intergenic
1056580077 9:87884005-87884027 GAAGCGGGAGGTCCAGGAGCAGG + Exonic
1056792163 9:89633031-89633053 GTCCCTGGAGGGCCAGGAAGTGG + Intergenic
1057261335 9:93586486-93586508 GCTGGGGGAGGGCCAGCAGCCGG + Intronic
1057263542 9:93599386-93599408 CTTGCTGGAGCAACAGGAGCTGG - Intronic
1057824397 9:98360963-98360985 GTTTGTGGAAGGCCTGGAGCTGG - Intronic
1058233558 9:102461504-102461526 GTTGCTGGTGGGGCAGGGGGTGG + Intergenic
1060183253 9:121548064-121548086 GTTGCTGGAGGGACAGCATGGGG - Intergenic
1060802118 9:126551425-126551447 GTTGCAGCAGGGGCAGGGGCAGG - Intergenic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061215485 9:129219314-129219336 TGTGCTGGAAGGTCAGGAGCTGG + Intergenic
1061582298 9:131545625-131545647 GGAGCTGGAGGGGCAGGTGCCGG + Intergenic
1061582303 9:131545640-131545662 GGTGCCGGAGGGGCAGGTGCTGG + Intergenic
1061582336 9:131545745-131545767 GGTGCTGGCGGGGCAGGTGCTGG + Intergenic
1061582357 9:131545815-131545837 GCTGCTGGAGGGGCAGGTGCTGG + Intergenic
1061654664 9:132079694-132079716 GACGCTGGAGGGCCGGGAGAAGG - Exonic
1062279671 9:135746381-135746403 GTTTCTGGGGTGCCAGGAGGAGG + Intronic
1062502966 9:136859087-136859109 GTGGCTGGAGGCCCAGGTGGAGG + Exonic
1203779984 EBV:95941-95963 GGAGCGGGAGGGGCAGGAGCAGG + Intergenic
1203779989 EBV:95956-95978 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780013 EBV:96019-96041 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780033 EBV:96073-96095 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780049 EBV:96118-96140 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780063 EBV:96154-96176 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780079 EBV:96199-96221 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780093 EBV:96235-96257 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780112 EBV:96286-96308 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780117 EBV:96301-96323 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780131 EBV:96337-96359 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780136 EBV:96352-96374 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780141 EBV:96367-96389 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780146 EBV:96382-96404 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780155 EBV:96406-96428 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780164 EBV:96430-96452 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780173 EBV:96454-96476 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780183 EBV:96481-96503 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780193 EBV:96508-96530 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780202 EBV:96532-96554 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780211 EBV:96556-96578 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780220 EBV:96580-96602 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780231 EBV:96613-96635 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203746597 Un_GL000218v1:43648-43670 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1203563512 Un_KI270744v1:75832-75854 GTTGCTTCTGGGCCAGCAGCAGG - Intergenic
1185759347 X:2677926-2677948 GCTGCCGGGTGGCCAGGAGCAGG + Intergenic
1185932559 X:4219245-4219267 ACTGATGGAGTGCCAGGAGCTGG - Intergenic
1186191138 X:7068694-7068716 GTGCCTGGAGGGACAGGAGCAGG + Intronic
1186658244 X:11639816-11639838 GTTGGTGGGGGGTCAGGAGCAGG - Intronic
1187186991 X:16996279-16996301 GTCACAGGAGGGCCAAGAGCAGG + Intronic
1189391587 X:40581092-40581114 GTTGGTGGCGGGTGAGGAGCCGG + Exonic
1190126115 X:47707191-47707213 TTTGCAGGAGGGCCAGGAAGGGG + Intergenic
1190621423 X:52290296-52290318 CCTGCTTGAGTGCCAGGAGCAGG + Intergenic
1190733046 X:53236976-53236998 GCTCCTGGAAGGGCAGGAGCAGG + Intronic
1193919443 X:87407212-87407234 CTTGGGGGAGGGCCAGGAGCAGG - Intergenic
1194835226 X:98673111-98673133 ATTGCTGGTGGTGCAGGAGCAGG + Intergenic
1198934680 X:141894549-141894571 GTTGCTGTCGGGACAGGAGAAGG + Intronic
1199319608 X:146422860-146422882 GTTCCTGGAGGTTCAGGAGAGGG - Intergenic
1199552319 X:149073848-149073870 GTGGATGGAGGGCAGGGAGCTGG - Intergenic
1200000145 X:153056120-153056142 CGTGCGGGAGGGGCAGGAGCCGG + Intergenic
1200183034 X:154162917-154162939 GCTGCCAGAGGGCCAGGAGATGG - Intergenic
1200188688 X:154200031-154200053 GCTGCCAGAGGGCCAGGAGATGG - Intergenic
1200194337 X:154237172-154237194 GCTGCCAGAGGGCCAGGAGATGG - Intergenic
1200200093 X:154274975-154274997 GCTGCCAGAGGGCCAGGAGATGG - Intronic
1200243990 X:154513042-154513064 GTGGCTGGAGGACAAGGAGGTGG + Intronic
1201159924 Y:11158662-11158684 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1201565216 Y:15358442-15358464 GTTCCAGGAGGGCCCTGAGCTGG - Intergenic
1201867877 Y:18673788-18673810 GCTGCTGGAGGGCGAGGACGCGG - Intergenic