ID: 1002126549

View in Genome Browser
Species Human (GRCh38)
Location 5:177049777-177049799
Sequence CAGAACTACCCCAATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002126549 Original CRISPR CAGAACTACCCCAATGAGGT AGG (reversed) Intronic
900165226 1:1241814-1241836 CAGAACTGCCCCATGGAGGGTGG - Intergenic
903421571 1:23221298-23221320 CATAACTAACCCCATGAGATAGG - Intergenic
903976503 1:27153866-27153888 CTGAACTACCCCCATAAAGTAGG - Intronic
905011845 1:34752633-34752655 TAGAAATAACCCTATGAGGTAGG - Intronic
907083578 1:51647954-51647976 CAGGATTACCCCCATGAAGTGGG - Intronic
908820957 1:68086125-68086147 CAAAACCAACCCAATGAGATAGG + Intergenic
909000668 1:70213733-70213755 CATAACAACCCCAATGAGGTGGG + Intronic
913435980 1:118848085-118848107 CAGTAACAACCCAATGAGGTAGG - Intergenic
913701686 1:121380593-121380615 CATAATAACCCCAATGAGGTTGG - Intronic
914042247 1:144061062-144061084 CATAATAACCCCAATGAGGTTGG - Intergenic
914135843 1:144899426-144899448 CATAATAACCCCAATGAGGTTGG + Intronic
919901804 1:202049278-202049300 GAGAACTACCCCTATTACGTAGG + Intergenic
920489110 1:206399313-206399335 CATAATAACCCCAATGAGGTTGG - Intronic
921476928 1:215622303-215622325 CACAGCGACCCTAATGAGGTAGG - Intergenic
921625803 1:217376513-217376535 CAGAACTACACCCATGAGGAAGG + Intergenic
921896330 1:220405313-220405335 AATAAGTACCCCATTGAGGTTGG - Intergenic
1063200464 10:3781915-3781937 CAAAACTTCGCCAATGGGGTCGG + Exonic
1072415445 10:95242924-95242946 GAGAACCAGCTCAATGAGGTCGG + Intronic
1073461149 10:103666699-103666721 CAGAACAATTCCCATGAGGTAGG - Intronic
1080021482 11:27565037-27565059 CACAATTATCCCAATGAGGCAGG + Intergenic
1081813683 11:45927138-45927160 CACAACTACCCCCACCAGGTGGG - Intronic
1082863048 11:57873576-57873598 CAGAACTACCCCTACGTGGCTGG - Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083259592 11:61515989-61516011 CACAACCTCCCCTATGAGGTAGG + Intronic
1083983730 11:66195490-66195512 CAAAACCACCCCAATGGTGTCGG - Intronic
1085905494 11:80756431-80756453 AAGACCTTCACCAATGAGGTTGG + Intergenic
1092381359 12:7999567-7999589 AAGATCTCCCCAAATGAGGTCGG - Intergenic
1094638539 12:32250314-32250336 CACAATAACCCCACTGAGGTAGG - Intronic
1096392556 12:51240283-51240305 CAGAGCTACCAAAATGAGGCAGG - Intronic
1099520104 12:83649879-83649901 CAAAACTACCCCCAAGAGGCCGG - Intergenic
1101262250 12:103045103-103045125 CAGTAACACCCCTATGAGGTAGG - Intergenic
1102080146 12:110091253-110091275 CAGAACAAACCACATGAGGTTGG - Intergenic
1103198224 12:119065052-119065074 CACAACCACTTCAATGAGGTGGG + Intronic
1111643712 13:91003403-91003425 CACAACAACCCTAATGTGGTAGG - Intergenic
1112203310 13:97299994-97300016 CAGAACTACCACAATATGGAAGG - Intronic
1114181015 14:20367903-20367925 CAGAACTACCCAGAGGAGGCCGG - Exonic
1117513859 14:56480880-56480902 AAGACCTACCCCAAAGAGCTTGG - Intergenic
1119189229 14:72669024-72669046 CAGAACAACCCAAAAGTGGTTGG + Intronic
1120810539 14:88798868-88798890 CAGTATTACCCCAGTGAGGCAGG + Intergenic
1121122844 14:91386887-91386909 CAGTACTACCTCATTGTGGTGGG - Intronic
1122079479 14:99257024-99257046 CACAGCAACCCTAATGAGGTGGG + Intronic
1122575095 14:102737118-102737140 CAGAACTCCTCCACTGAGCTTGG + Intergenic
1132787680 16:1667017-1667039 CAGAGCTGCCCCAAGGAGGGTGG + Intronic
1133692608 16:8231081-8231103 AAGAATAACCCCAATGAAGTGGG + Intergenic
1135039554 16:19107539-19107561 CAGAACAAGCCCAATGAGGCAGG - Intergenic
1137764642 16:50968464-50968486 CTGAACCTCCCCTATGAGGTAGG - Intergenic
1138573067 16:57888259-57888281 CAGAACAACTGTAATGAGGTGGG + Intronic
1142964228 17:3571011-3571033 CAGAAAAACCCCAAGGAGGCCGG - Intronic
1144662919 17:17082940-17082962 CAGACCTACCACAATCAGGAGGG - Intronic
1144710280 17:17397108-17397130 AAGAACTACCTCAATCAGCTAGG + Intergenic
1147476853 17:40720167-40720189 CAGAACAACCCCAAGGAGATAGG - Intergenic
1148939785 17:51198498-51198520 CAGAACTACCCCACTTACATGGG + Intronic
1150656709 17:67044341-67044363 CAGAAATACCCCAGTGCGGCGGG - Intergenic
1154143922 18:11850421-11850443 CAAATCTGCCCTAATGAGGTAGG - Intronic
1161295752 19:3519415-3519437 CTGATCTACCCCAAGGAGGGCGG + Intronic
1163076054 19:14892709-14892731 CAGAAATAGCCCAAAGAGGAAGG + Intergenic
1168018614 19:53593296-53593318 CAGGAATACCCCAATGATGAAGG + Intergenic
925476148 2:4217707-4217729 CACAACTACCTCTATGAAGTAGG + Intergenic
927274017 2:21246142-21246164 CTCAAGTACCCCAATGATGTAGG - Intergenic
929906291 2:46049303-46049325 CAGCACTAATCCAGTGAGGTGGG - Intronic
930553724 2:52869238-52869260 GAGATCTACCCCAGTGAGGATGG - Intergenic
931434148 2:62232634-62232656 CAAAACCACCCCACTGAGGCTGG + Intergenic
932730633 2:74219554-74219576 CAGTAAAACACCAATGAGGTTGG + Intronic
933647339 2:84823430-84823452 AAGAACTACCCCAGAGAGGCTGG - Intronic
935131909 2:100266932-100266954 CACAGCTGCCCCAATGAGTTAGG - Intergenic
935224849 2:101044611-101044633 CAGAAGCACCCCTATGAGGATGG + Intronic
941760569 2:169237985-169238007 GAGAGCTACCCAGATGAGGTAGG + Intronic
941765145 2:169288670-169288692 CTGAACTACTTCCATGAGGTTGG - Intronic
942215154 2:173712181-173712203 CAGAAATACAGCAAGGAGGTGGG + Intergenic
945552249 2:211234937-211234959 CACAACAATCCCAATTAGGTAGG + Intergenic
1172563250 20:35907633-35907655 CAGAACAAACCCTCTGAGGTGGG + Intronic
1179534404 21:42042049-42042071 CAGAACTGCCCCATGGAGGGAGG - Intergenic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
949426975 3:3928327-3928349 CAGAACAACCCCAAAGTTGTAGG - Intronic
954438876 3:50510811-50510833 CAGCACCACCCCAAGGAGGCAGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955578771 3:60396087-60396109 CAGAACTACCCCCATGTGACAGG + Intronic
956614058 3:71153260-71153282 CAGGAATACCCCAGTGAGATGGG + Intronic
956951144 3:74284470-74284492 CATAACTACTCCCAAGAGGTAGG - Intronic
958916578 3:100057034-100057056 CAGAGCTACCCCAAAGTTGTGGG - Intronic
958938053 3:100279249-100279271 CATAACAATCCCTATGAGGTAGG - Intronic
961987043 3:131145840-131145862 CACAACAATCCTAATGAGGTAGG - Intronic
966266014 3:178044327-178044349 GAGAACCAACACAATGAGGTTGG - Intergenic
969870782 4:10103378-10103400 CAGAAATGCCACCATGAGGTTGG - Intronic
970420545 4:15901905-15901927 CAGAACTACCTCAAAGTGGCAGG + Intergenic
976080786 4:81352628-81352650 CACAACTAGCCCAATGAATTAGG + Intergenic
981603224 4:146515611-146515633 AAAAAATACCCCAATGAGGCCGG + Intronic
981929930 4:150178652-150178674 CAGAACTGCCCCACTGATTTTGG + Intronic
990355829 5:54965233-54965255 CACAACAACCCCATTGAGGCAGG - Intergenic
990739269 5:58895568-58895590 CAGAACAACCTTTATGAGGTAGG - Intergenic
991064487 5:62411224-62411246 CAGAACAACCCTTATGAGGTAGG - Intronic
991578669 5:68131514-68131536 CAGAGATACCTGAATGAGGTAGG - Intergenic
992718329 5:79533347-79533369 CATAACAACCCTAATGGGGTAGG + Intergenic
996208284 5:120771340-120771362 CAGAACTACTGCAATGTGTTTGG - Intergenic
996342132 5:122450911-122450933 CAAGACTACCCCAGTGAGGAAGG + Exonic
997692577 5:135836739-135836761 TATAACAACCCCAAAGAGGTAGG + Intronic
998788404 5:145737934-145737956 CAGAACTACCTCAGTGCGGCAGG - Intronic
999104627 5:149060374-149060396 CAGAACTCCCCTAATCAGGGGGG - Intronic
999702252 5:154238915-154238937 CAGAACCTCCCCCATGAGGCTGG - Intronic
1001444637 5:171773915-171773937 GAGGACTACACCAAGGAGGTGGG + Exonic
1002126549 5:177049777-177049799 CAGAACTACCCCAATGAGGTAGG - Intronic
1003152523 6:3564558-3564580 AAAAACTACCCCCATGAGGCCGG - Intergenic
1003770808 6:9297456-9297478 CACATCTCCTCCAATGAGGTTGG + Intergenic
1004549649 6:16634376-16634398 CAGAAACAACCCTATGAGGTAGG - Intronic
1005782745 6:29210076-29210098 CAAAACTACCCATATGAGCTGGG + Intergenic
1006711187 6:36072884-36072906 CAGATCTGCCCCCATGAGATGGG - Exonic
1007856310 6:44861848-44861870 CAGAACTGCCCAGTTGAGGTTGG - Intronic
1015545190 6:134354742-134354764 CAAAACCACACCAAAGAGGTGGG - Intergenic
1018664241 6:166119745-166119767 CAGAACTACCCCTATGGTGCTGG + Intergenic
1036566921 8:9945654-9945676 CAGAACCACAGCAGTGAGGTGGG - Intergenic
1036632890 8:10527797-10527819 CATAACTGCCCTATTGAGGTAGG - Intronic
1041550848 8:59099275-59099297 CAGAACTAACCAAATGATGTGGG - Intronic
1042191875 8:66195210-66195232 CAGCAATACCTCTATGAGGTAGG - Intergenic
1042430299 8:68698930-68698952 TACAACTACCACAATGAGGATGG + Intronic
1042780808 8:72489355-72489377 GAGAATTTCCCTAATGAGGTAGG + Intergenic
1043555064 8:81421083-81421105 CACAACTACCCAACTGAGGAAGG - Intergenic
1045413370 8:101942557-101942579 AAGAACTACCCCAATTACATAGG + Intronic
1045806724 8:106170978-106171000 AGGAAGTACCCCAATGAAGTTGG - Intergenic
1045942251 8:107752851-107752873 CAAAACCAACCCTATGAGGTGGG + Intergenic
1057896819 9:98915807-98915829 CACAAGTGCCCTAATGAGGTAGG - Intergenic
1058391914 9:104504990-104505012 CAAAACTACCACCATCAGGTGGG - Exonic
1203778733 EBV:88652-88674 CAGATCCATCCCACTGAGGTGGG - Intergenic
1186943429 X:14538274-14538296 CAGTACAACCCAAGTGAGGTAGG - Intronic
1190148528 X:47920688-47920710 CAGGCCTACCCCATGGAGGTAGG + Exonic
1192586990 X:72326963-72326985 CGCAACCACCCCCATGAGGTAGG + Intergenic
1195029155 X:100909574-100909596 CACAACAACCCTTATGAGGTAGG - Intergenic
1198429514 X:136551622-136551644 CACACCTCACCCAATGAGGTGGG - Intronic
1199900668 X:152168965-152168987 CAGAGCAACCCCTATGAGGTAGG + Intronic
1201598828 Y:15704659-15704681 CAAAACTAACCAACTGAGGTGGG + Intergenic