ID: 1002133794

View in Genome Browser
Species Human (GRCh38)
Location 5:177096368-177096390
Sequence TGGGGTAGGACAGTGACCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002133794_1002133802 11 Left 1002133794 5:177096368-177096390 CCGGCGGTCACTGTCCTACCCCA 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1002133802 5:177096402-177096424 AGGCACTGCCCAAAGTCACGTGG 0: 1
1: 0
2: 1
3: 19
4: 234
1002133794_1002133803 18 Left 1002133794 5:177096368-177096390 CCGGCGGTCACTGTCCTACCCCA 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1002133803 5:177096409-177096431 GCCCAAAGTCACGTGGCCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 130
1002133794_1002133798 -9 Left 1002133794 5:177096368-177096390 CCGGCGGTCACTGTCCTACCCCA 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1002133798 5:177096382-177096404 CCTACCCCACAAAAAGGGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002133794 Original CRISPR TGGGGTAGGACAGTGACCGC CGG (reversed) Intronic
901055937 1:6448617-6448639 TGCGGGAAGACAGTGACCGGTGG - Intronic
902478458 1:16700022-16700044 TGCGGGAAGACAGTGACCGGTGG + Intergenic
902826524 1:18978467-18978489 TGGGGTAGGGCAGTGCCCAGGGG - Intergenic
903306169 1:22414744-22414766 TGGGGAAGGAGAGTGACAGTGGG - Intergenic
905690083 1:39936610-39936632 TGAGGTAGGACAGTGATGGGGGG + Intergenic
905857525 1:41323823-41323845 TGGGGTAGGGCAGCGGGCGCTGG - Intergenic
905890798 1:41517145-41517167 TGGGGCAGGGCAGGGACCTCAGG + Intronic
907272671 1:53300016-53300038 TTTGGTAGGACAGTGACTACTGG - Intronic
909802106 1:79822545-79822567 GGGGCTAGGACAGAGACGGCAGG - Intergenic
910003156 1:82361116-82361138 TTGGTTAGGAGAGTGACTGCAGG - Intergenic
915832229 1:159141775-159141797 TGGGGGGGGACAGGGACAGCTGG + Intronic
917517445 1:175719776-175719798 TGGGGTAGGGAAGGGACAGCAGG - Intronic
919060441 1:192625326-192625348 TGGGGCAGAACAGTGAATGCAGG - Intergenic
919088097 1:192945600-192945622 TGGGGTGGGATCCTGACCGCTGG - Intergenic
919733759 1:200931342-200931364 TGAGGCAGGACAGTTACAGCAGG - Intergenic
921978698 1:221230714-221230736 TGGGCTAGGGCATTGACCTCAGG + Intergenic
924321436 1:242854939-242854961 TGGGTGAGGACTGTGACTGCTGG - Intergenic
1064020082 10:11801958-11801980 TGGAGTAGGACAGTGGACACTGG + Intergenic
1064196799 10:13250343-13250365 AGGGGCAGGGCAGTGACCGATGG + Intergenic
1072564749 10:96608191-96608213 TGGGGAAGGAGAGTGACAGCTGG - Intronic
1074537885 10:114341710-114341732 TGGAGTATGACAGTGACCACGGG - Intronic
1075982778 10:126755688-126755710 TGGGTGAGGACAGTGACTGCTGG - Intergenic
1076693456 10:132235718-132235740 TGAGGTGGGTCCGTGACCGCCGG - Intronic
1082106625 11:48228302-48228324 TTGGGCAGGACAGTGAACTCAGG + Intergenic
1082818884 11:57530267-57530289 AGGGGTAGGAGAGTGAACGGCGG - Intronic
1083404146 11:62445014-62445036 TGGGGTAGGACTGTGACCGAAGG - Intronic
1085520957 11:77138562-77138584 TGGGGGAGGTCAGAGACCGCAGG - Intronic
1086078789 11:82881448-82881470 GGGGGTAGGACAGCCCCCGCTGG + Intronic
1090038626 11:123270859-123270881 TTGGTTAGGACAGTGTCTGCCGG - Intergenic
1097763389 12:63494715-63494737 TGGGGTAGCACAGAAACAGCAGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1103025633 12:117571611-117571633 TGATGTAAGACTGTGACCGCTGG + Intronic
1107803463 13:44132115-44132137 AGGGATAGGACAGTAACTGCAGG + Intergenic
1112105879 13:96238726-96238748 TGGGGTAAAACAGTGATCGGAGG - Intronic
1114336943 14:21699922-21699944 TGGGTTAGGCCAGTAACTGCTGG + Intergenic
1115474446 14:33800206-33800228 TGGGGGAGGACAGCAGCCGCGGG - Exonic
1122078106 14:99248404-99248426 TGGGGGCGGCCAGTGACCTCTGG - Intronic
1122603353 14:102932020-102932042 TGGGGTAGGCCAGAGGCCCCAGG - Intronic
1125719393 15:41838157-41838179 TGGGGGAGGACAGTAACCATAGG - Intronic
1126869999 15:52977487-52977509 TGGCCTAGGATAATGACCGCAGG + Intergenic
1131814941 15:96212398-96212420 TGGGGTAGGCCAGTTACCTGGGG - Intergenic
1132498589 16:275089-275111 AGGGGTGGGACGGTGAGCGCGGG + Intronic
1134364266 16:13562188-13562210 TTGGGTAGGACAGAAACCCCTGG + Intergenic
1134656435 16:15951004-15951026 TGGGGTTGGAGAGTAACCCCAGG + Intronic
1134665361 16:16014761-16014783 TGGGGTAGGAAAGTCACCAAGGG - Intronic
1135179048 16:20257200-20257222 TGGGGTAGGGCAGTGCTGGCTGG - Intergenic
1136172763 16:28498371-28498393 TGGGGTGGGGAAGAGACCGCGGG + Intronic
1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG + Intergenic
1141704207 16:85655753-85655775 TGGGGTAGAACGGGGACCTCAGG - Exonic
1142262966 16:89051165-89051187 TGGGGTCGGACAGAGCCGGCAGG - Intergenic
1143427883 17:6854332-6854354 TGGGGGAGGCCTGTGACTGCCGG + Intergenic
1144420684 17:15095319-15095341 TGGGGTTGGACTGTAACTGCAGG + Intergenic
1150484058 17:65532011-65532033 TGGGGTAGGACAGGGACACAGGG - Intronic
1152512685 17:80801194-80801216 TGGGGAATGATAGTGACCGTAGG + Intronic
1158662626 18:59402429-59402451 TGTGGAAGGACAGTGAAGGCAGG - Intergenic
1160985089 19:1834913-1834935 TGGGGGAGCCCAGTGACCACAGG - Intronic
1161025354 19:2034165-2034187 TGGGGAAAGGCAGTGACTGCCGG + Intronic
1162125915 19:8499458-8499480 TTGGGGAGGTCAGTGACCTCAGG + Exonic
1162125926 19:8499494-8499516 TTGGGGAGGTCAGTGACCTCAGG + Exonic
1162125937 19:8499530-8499552 TTGGGGAGGTCAGTGACCTCAGG + Exonic
1162125948 19:8499566-8499588 TTGGGGAGGTCAGTGACCTCAGG + Exonic
1162135161 19:8550798-8550820 AGGGGTAGGACAGGGACCCAAGG - Intronic
1165384061 19:35500210-35500232 TGGGCTAGGACAGTAAAGGCAGG - Intronic
1165483983 19:36084322-36084344 TGGGGTAGGACAGGGGCCAGGGG - Intronic
1168072359 19:53960162-53960184 TGGGGTAAGCCTGTGACCCCAGG - Intergenic
1202712477 1_KI270714v1_random:25853-25875 TGCGGGAAGACAGTGACCGGTGG + Intergenic
929043840 2:37772080-37772102 TGGGGTAGGACAGAGAGAGCAGG - Intergenic
929574307 2:43042360-43042382 TGGGGTAGGGCAGTCAGGGCAGG + Intergenic
931525242 2:63145543-63145565 TGGGTGAGGCCAGTGACTGCCGG - Intronic
932910735 2:75803740-75803762 TGGGGTAGAACAGTGGCTGGAGG - Intergenic
943544705 2:189260361-189260383 TTGGGTAGCCCAGTGACTGCAGG + Intergenic
944070015 2:195657636-195657658 CGGGGTGGGGGAGTGACCGCTGG + Intronic
945802201 2:214447882-214447904 GAGGGTAAGACAGTGACTGCTGG - Intronic
946130360 2:217601787-217601809 TGAGGTGGGAGAGTGGCCGCTGG + Intronic
947134565 2:226964312-226964334 TGGGGAAGGAAAGTGACTCCAGG - Intronic
947633391 2:231667554-231667576 GGGTGTAGGACATTGACCTCAGG + Intergenic
947647266 2:231752182-231752204 TGGGGTAAGACAGAAACCACAGG + Intronic
948809225 2:240466383-240466405 TGGGGTGGGACAGGGAGGGCCGG + Exonic
948993024 2:241564259-241564281 TGGGGAGGGGCAGTGACCTCAGG + Intronic
1175495284 20:59410317-59410339 TGGGGTAATAGAGTGACAGCTGG - Intergenic
1182869716 22:33635342-33635364 AGGGGTGGACCAGTGACCGCAGG - Intronic
1183430216 22:37761512-37761534 TGGGGTCAGACAGTGACATCAGG + Intronic
1203295972 22_KI270736v1_random:43477-43499 CGGGGTAGGACAGAGAGAGCAGG - Intergenic
949312205 3:2712788-2712810 TTGGTTAAGACAGTGACCACTGG - Intronic
955840547 3:63108326-63108348 TGGGGCAGGATAGTGACTGCCGG + Intergenic
956114477 3:65904515-65904537 TGGGGTAGAACAGTGGGAGCTGG - Intronic
956586351 3:70869308-70869330 TGGGGTAGGACATTTGCTGCAGG - Intergenic
957700834 3:83708796-83708818 TGGAGCAGAACAGTGACCTCAGG + Intergenic
961443339 3:126965899-126965921 TGGGGAAGTCCAGTGACCCCAGG + Intergenic
961745841 3:129062998-129063020 TGGGGTAGGAGGGGGACCCCAGG - Intergenic
965716614 3:171611669-171611691 AGGGGTATGCCAGTGACTGCTGG - Intronic
981559703 4:146033436-146033458 TGGGTGAGGCCAGTGACTGCTGG + Intergenic
985689739 5:1300573-1300595 TGGGGGCGGACAGCGACGGCGGG - Intergenic
990467099 5:56080690-56080712 TGGGGAAGGACAGTGAGAGGAGG - Intergenic
991577181 5:68116565-68116587 TGGGGTCGCACAGTAACCACTGG - Intergenic
995879675 5:116830337-116830359 GAGGGTAGGACAGTGCCTGCTGG - Intergenic
996794965 5:127335240-127335262 TGGGGCAGGACAGTGTCTGAGGG + Intronic
996996014 5:129697427-129697449 TGGGGTAGGACTGTTAGAGCAGG - Intronic
997355484 5:133260143-133260165 TGGGGTTGGACTGTGTCCGGCGG + Intronic
998211760 5:140204966-140204988 TGGGGTAGGACTGTGATATCTGG + Intronic
999256408 5:150212076-150212098 GAGGGCAGGACAGGGACCGCAGG - Intronic
999859083 5:155625897-155625919 TGTGGAAGGACAGTGAACTCTGG - Intergenic
1000147868 5:158470930-158470952 TCAGGTAGGACAGTGAGCACTGG + Intergenic
1001493795 5:172173845-172173867 TGAGGCAGGACAGTGAGGGCTGG + Intronic
1001741290 5:174055079-174055101 TGGGGTAGCCCTGTGACCTCCGG - Intronic
1002133794 5:177096368-177096390 TGGGGTAGGACAGTGACCGCCGG - Intronic
1005434452 6:25793333-25793355 TGGGATAGAACAGTGAGAGCTGG + Intronic
1006925550 6:37652386-37652408 TGGGGTGGGACATGGACCCCTGG - Intronic
1010165128 6:72906184-72906206 TGGGTGAGGACTGTGACAGCAGG - Intronic
1013950580 6:115776310-115776332 TGGTGCAGGACAGTGACCAGAGG + Intergenic
1014336806 6:120147361-120147383 TGGGTGAGGCCAGTGACTGCTGG + Intergenic
1018282789 6:162206065-162206087 TGGGGTAGGACAGAAACAGGGGG + Intronic
1019257896 7:63360-63382 TGGGGTACGACGGTGAGCACTGG + Intergenic
1019743651 7:2688080-2688102 TGGGGCAGGACGCTGAGCGCCGG + Intronic
1021361537 7:19718993-19719015 TATGGTAGGACAGAGACTGCAGG - Intergenic
1022989545 7:35694671-35694693 TGGGGCGGGGCAGTGACCCCGGG - Exonic
1033763554 7:144463177-144463199 TGGGGCAGGCCAGTGTCCACAGG - Intronic
1035062788 7:156081524-156081546 GGGGGTAGTGCAGTGACTGCCGG + Intergenic
1039118998 8:34124978-34125000 TGGGGTAGCACAGTGGAGGCAGG + Intergenic
1040288825 8:46113977-46113999 TGGGGAAGCAGAGAGACCGCAGG - Intergenic
1048415715 8:134225682-134225704 TGGGGTAGAACTGTGGCCGTAGG - Intergenic
1049725126 8:144142274-144142296 GGGGTTAGGCCAGTGACCTCAGG + Intergenic
1053148200 9:35726289-35726311 TGGGGCAGGGCAGTGTCCTCAGG - Intronic
1060829426 9:126704395-126704417 TGGGGCAGACCAGTGACAGCTGG - Intergenic
1060987066 9:127825837-127825859 TGCAGAAGGACAGTGACCCCTGG + Exonic
1061852416 9:133423909-133423931 TGGGAGAGGACAGTGAGGGCTGG + Intronic
1192170013 X:68848414-68848436 TGGGCTGGGACAGTCACCCCAGG + Intergenic
1194474390 X:94340786-94340808 TGGGGCAGTAGAGTGACCCCTGG - Intergenic
1194997680 X:100609671-100609693 TGGGGTAGGAATGTGACCCTTGG - Intergenic
1199953397 X:152723355-152723377 TGTCGTAGGGCAGTGATCGCTGG + Intergenic
1199956285 X:152745095-152745117 TGTCGTAGGGCAGTGATCGCTGG - Intergenic
1200209835 X:154342308-154342330 CGGGGGAAGACAGTGACCACCGG - Intergenic
1200221017 X:154389784-154389806 CGGGGGAAGACAGTGACCACCGG + Intergenic