ID: 1002139431

View in Genome Browser
Species Human (GRCh38)
Location 5:177130038-177130060
Sequence TTTCACAGGCAGTATGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139424_1002139431 26 Left 1002139424 5:177129989-177130011 CCTGTCATTCAAATTTCTGGGCA No data
Right 1002139431 5:177130038-177130060 TTTCACAGGCAGTATGTGTAGGG No data
1002139425_1002139431 3 Left 1002139425 5:177130012-177130034 CCTGTGTGTAAGCACCATGCTGG No data
Right 1002139431 5:177130038-177130060 TTTCACAGGCAGTATGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139431 Original CRISPR TTTCACAGGCAGTATGTGTA GGG Intergenic
No off target data available for this crispr