ID: 1002139927

View in Genome Browser
Species Human (GRCh38)
Location 5:177132560-177132582
Sequence TCCCCAGCCCGGGCCCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139927_1002139933 -8 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139933 5:177132575-177132597 GCTGGGGACTCGGCCTCCCTGGG No data
1002139927_1002139932 -9 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139932 5:177132574-177132596 GGCTGGGGACTCGGCCTCCCTGG No data
1002139927_1002139935 -4 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139935 5:177132579-177132601 GGGACTCGGCCTCCCTGGGCGGG No data
1002139927_1002139936 -3 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139936 5:177132580-177132602 GGACTCGGCCTCCCTGGGCGGGG No data
1002139927_1002139937 -2 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139937 5:177132581-177132603 GACTCGGCCTCCCTGGGCGGGGG No data
1002139927_1002139943 19 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139943 5:177132602-177132624 GGCCGCACGGCTGCAGGCCGAGG No data
1002139927_1002139945 24 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139927_1002139942 13 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139942 5:177132596-177132618 GGCGGGGGCCGCACGGCTGCAGG No data
1002139927_1002139939 6 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139939 5:177132589-177132611 CTCCCTGGGCGGGGGCCGCACGG No data
1002139927_1002139934 -5 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139934 5:177132578-177132600 GGGGACTCGGCCTCCCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139927 Original CRISPR TCCCCAGCCCGGGCCCAGCC GGG (reversed) Intergenic