ID: 1002139928

View in Genome Browser
Species Human (GRCh38)
Location 5:177132561-177132583
Sequence GTCCCCAGCCCGGGCCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139928_1002139942 12 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139942 5:177132596-177132618 GGCGGGGGCCGCACGGCTGCAGG No data
1002139928_1002139932 -10 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139932 5:177132574-177132596 GGCTGGGGACTCGGCCTCCCTGG No data
1002139928_1002139935 -5 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139935 5:177132579-177132601 GGGACTCGGCCTCCCTGGGCGGG No data
1002139928_1002139939 5 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139939 5:177132589-177132611 CTCCCTGGGCGGGGGCCGCACGG No data
1002139928_1002139943 18 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139943 5:177132602-177132624 GGCCGCACGGCTGCAGGCCGAGG No data
1002139928_1002139934 -6 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139934 5:177132578-177132600 GGGGACTCGGCCTCCCTGGGCGG No data
1002139928_1002139933 -9 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139933 5:177132575-177132597 GCTGGGGACTCGGCCTCCCTGGG No data
1002139928_1002139936 -4 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139936 5:177132580-177132602 GGACTCGGCCTCCCTGGGCGGGG No data
1002139928_1002139945 23 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139928_1002139937 -3 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139937 5:177132581-177132603 GACTCGGCCTCCCTGGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139928 Original CRISPR GTCCCCAGCCCGGGCCCAGC CGG (reversed) Intergenic