ID: 1002139931

View in Genome Browser
Species Human (GRCh38)
Location 5:177132571-177132593
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139931_1002139939 -5 Left 1002139931 5:177132571-177132593 CCGGGCTGGGGACTCGGCCTCCC No data
Right 1002139939 5:177132589-177132611 CTCCCTGGGCGGGGGCCGCACGG No data
1002139931_1002139947 26 Left 1002139931 5:177132571-177132593 CCGGGCTGGGGACTCGGCCTCCC No data
Right 1002139947 5:177132620-177132642 CGAGGTGCGGACGCGCTGTCAGG No data
1002139931_1002139942 2 Left 1002139931 5:177132571-177132593 CCGGGCTGGGGACTCGGCCTCCC No data
Right 1002139942 5:177132596-177132618 GGCGGGGGCCGCACGGCTGCAGG No data
1002139931_1002139945 13 Left 1002139931 5:177132571-177132593 CCGGGCTGGGGACTCGGCCTCCC No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139931_1002139943 8 Left 1002139931 5:177132571-177132593 CCGGGCTGGGGACTCGGCCTCCC No data
Right 1002139943 5:177132602-177132624 GGCCGCACGGCTGCAGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139931 Original CRISPR GGGAGGCCGAGTCCCCAGCC CGG (reversed) Intergenic