ID: 1002139938

View in Genome Browser
Species Human (GRCh38)
Location 5:177132588-177132610
Sequence CGTGCGGCCCCCGCCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139938_1002139948 20 Left 1002139938 5:177132588-177132610 CCTCCCTGGGCGGGGGCCGCACG No data
Right 1002139948 5:177132631-177132653 CGCGCTGTCAGGCTGCAGCCCGG No data
1002139938_1002139945 -4 Left 1002139938 5:177132588-177132610 CCTCCCTGGGCGGGGGCCGCACG No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139938_1002139947 9 Left 1002139938 5:177132588-177132610 CCTCCCTGGGCGGGGGCCGCACG No data
Right 1002139947 5:177132620-177132642 CGAGGTGCGGACGCGCTGTCAGG No data
1002139938_1002139943 -9 Left 1002139938 5:177132588-177132610 CCTCCCTGGGCGGGGGCCGCACG No data
Right 1002139943 5:177132602-177132624 GGCCGCACGGCTGCAGGCCGAGG No data
1002139938_1002139949 25 Left 1002139938 5:177132588-177132610 CCTCCCTGGGCGGGGGCCGCACG No data
Right 1002139949 5:177132636-177132658 TGTCAGGCTGCAGCCCGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139938 Original CRISPR CGTGCGGCCCCCGCCCAGGG AGG (reversed) Intergenic