ID: 1002139941

View in Genome Browser
Species Human (GRCh38)
Location 5:177132592-177132614
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139941_1002139951 28 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139951 5:177132643-177132665 CTGCAGCCCGGCTCGGTGCCGGG No data
1002139941_1002139947 5 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139947 5:177132620-177132642 CGAGGTGCGGACGCGCTGTCAGG No data
1002139941_1002139949 21 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139949 5:177132636-177132658 TGTCAGGCTGCAGCCCGGCTCGG No data
1002139941_1002139952 29 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139952 5:177132644-177132666 TGCAGCCCGGCTCGGTGCCGGGG No data
1002139941_1002139950 27 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139950 5:177132642-177132664 GCTGCAGCCCGGCTCGGTGCCGG No data
1002139941_1002139953 30 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139953 5:177132645-177132667 GCAGCCCGGCTCGGTGCCGGGGG No data
1002139941_1002139945 -8 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139941_1002139948 16 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139948 5:177132631-177132653 CGCGCTGTCAGGCTGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139941 Original CRISPR CAGCCGTGCGGCCCCCGCCC AGG (reversed) Intergenic