ID: 1002139944

View in Genome Browser
Species Human (GRCh38)
Location 5:177132604-177132626
Sequence CACCTCGGCCTGCAGCCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139944_1002139956 22 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139956 5:177132649-177132671 CCCGGCTCGGTGCCGGGGGTGGG No data
1002139944_1002139949 9 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139949 5:177132636-177132658 TGTCAGGCTGCAGCCCGGCTCGG No data
1002139944_1002139953 18 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139953 5:177132645-177132667 GCAGCCCGGCTCGGTGCCGGGGG No data
1002139944_1002139948 4 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139948 5:177132631-177132653 CGCGCTGTCAGGCTGCAGCCCGG No data
1002139944_1002139952 17 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139952 5:177132644-177132666 TGCAGCCCGGCTCGGTGCCGGGG No data
1002139944_1002139951 16 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139951 5:177132643-177132665 CTGCAGCCCGGCTCGGTGCCGGG No data
1002139944_1002139947 -7 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139947 5:177132620-177132642 CGAGGTGCGGACGCGCTGTCAGG No data
1002139944_1002139954 21 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139954 5:177132648-177132670 GCCCGGCTCGGTGCCGGGGGTGG No data
1002139944_1002139950 15 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139950 5:177132642-177132664 GCTGCAGCCCGGCTCGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139944 Original CRISPR CACCTCGGCCTGCAGCCGTG CGG (reversed) Intergenic