ID: 1002139945

View in Genome Browser
Species Human (GRCh38)
Location 5:177132607-177132629
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139927_1002139945 24 Left 1002139927 5:177132560-177132582 CCCGGCTGGGCCCGGGCTGGGGA No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139941_1002139945 -8 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139928_1002139945 23 Left 1002139928 5:177132561-177132583 CCGGCTGGGCCCGGGCTGGGGAC No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139930_1002139945 14 Left 1002139930 5:177132570-177132592 CCCGGGCTGGGGACTCGGCCTCC No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139940_1002139945 -7 Left 1002139940 5:177132591-177132613 CCCTGGGCGGGGGCCGCACGGCT No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139931_1002139945 13 Left 1002139931 5:177132571-177132593 CCGGGCTGGGGACTCGGCCTCCC No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data
1002139938_1002139945 -4 Left 1002139938 5:177132588-177132610 CCTCCCTGGGCGGGGGCCGCACG No data
Right 1002139945 5:177132607-177132629 CACGGCTGCAGGCCGAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139945 Original CRISPR CACGGCTGCAGGCCGAGGTG CGG Intergenic