ID: 1002139946

View in Genome Browser
Species Human (GRCh38)
Location 5:177132619-177132641
Sequence CTGACAGCGCGTCCGCACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139946_1002139951 1 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139951 5:177132643-177132665 CTGCAGCCCGGCTCGGTGCCGGG No data
1002139946_1002139952 2 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139952 5:177132644-177132666 TGCAGCCCGGCTCGGTGCCGGGG No data
1002139946_1002139960 19 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139960 5:177132661-177132683 CCGGGGGTGGGCTCAGCGCTGGG No data
1002139946_1002139956 7 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139956 5:177132649-177132671 CCCGGCTCGGTGCCGGGGGTGGG No data
1002139946_1002139949 -6 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139949 5:177132636-177132658 TGTCAGGCTGCAGCCCGGCTCGG No data
1002139946_1002139962 28 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139962 5:177132670-177132692 GGCTCAGCGCTGGGGTCGCCTGG No data
1002139946_1002139954 6 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139954 5:177132648-177132670 GCCCGGCTCGGTGCCGGGGGTGG No data
1002139946_1002139958 18 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139958 5:177132660-177132682 GCCGGGGGTGGGCTCAGCGCTGG No data
1002139946_1002139950 0 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139950 5:177132642-177132664 GCTGCAGCCCGGCTCGGTGCCGG No data
1002139946_1002139961 20 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139961 5:177132662-177132684 CGGGGGTGGGCTCAGCGCTGGGG No data
1002139946_1002139953 3 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139953 5:177132645-177132667 GCAGCCCGGCTCGGTGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139946 Original CRISPR CTGACAGCGCGTCCGCACCT CGG (reversed) Intergenic
No off target data available for this crispr