ID: 1002139947

View in Genome Browser
Species Human (GRCh38)
Location 5:177132620-177132642
Sequence CGAGGTGCGGACGCGCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139931_1002139947 26 Left 1002139931 5:177132571-177132593 CCGGGCTGGGGACTCGGCCTCCC No data
Right 1002139947 5:177132620-177132642 CGAGGTGCGGACGCGCTGTCAGG No data
1002139944_1002139947 -7 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139947 5:177132620-177132642 CGAGGTGCGGACGCGCTGTCAGG No data
1002139940_1002139947 6 Left 1002139940 5:177132591-177132613 CCCTGGGCGGGGGCCGCACGGCT No data
Right 1002139947 5:177132620-177132642 CGAGGTGCGGACGCGCTGTCAGG No data
1002139930_1002139947 27 Left 1002139930 5:177132570-177132592 CCCGGGCTGGGGACTCGGCCTCC No data
Right 1002139947 5:177132620-177132642 CGAGGTGCGGACGCGCTGTCAGG No data
1002139938_1002139947 9 Left 1002139938 5:177132588-177132610 CCTCCCTGGGCGGGGGCCGCACG No data
Right 1002139947 5:177132620-177132642 CGAGGTGCGGACGCGCTGTCAGG No data
1002139941_1002139947 5 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139947 5:177132620-177132642 CGAGGTGCGGACGCGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139947 Original CRISPR CGAGGTGCGGACGCGCTGTC AGG Intergenic