ID: 1002139948

View in Genome Browser
Species Human (GRCh38)
Location 5:177132631-177132653
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139941_1002139948 16 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139948 5:177132631-177132653 CGCGCTGTCAGGCTGCAGCCCGG No data
1002139940_1002139948 17 Left 1002139940 5:177132591-177132613 CCCTGGGCGGGGGCCGCACGGCT No data
Right 1002139948 5:177132631-177132653 CGCGCTGTCAGGCTGCAGCCCGG No data
1002139938_1002139948 20 Left 1002139938 5:177132588-177132610 CCTCCCTGGGCGGGGGCCGCACG No data
Right 1002139948 5:177132631-177132653 CGCGCTGTCAGGCTGCAGCCCGG No data
1002139944_1002139948 4 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139948 5:177132631-177132653 CGCGCTGTCAGGCTGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139948 Original CRISPR CGCGCTGTCAGGCTGCAGCC CGG Intergenic