ID: 1002139953

View in Genome Browser
Species Human (GRCh38)
Location 5:177132645-177132667
Sequence GCAGCCCGGCTCGGTGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139941_1002139953 30 Left 1002139941 5:177132592-177132614 CCTGGGCGGGGGCCGCACGGCTG No data
Right 1002139953 5:177132645-177132667 GCAGCCCGGCTCGGTGCCGGGGG No data
1002139944_1002139953 18 Left 1002139944 5:177132604-177132626 CCGCACGGCTGCAGGCCGAGGTG No data
Right 1002139953 5:177132645-177132667 GCAGCCCGGCTCGGTGCCGGGGG No data
1002139946_1002139953 3 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139953 5:177132645-177132667 GCAGCCCGGCTCGGTGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139953 Original CRISPR GCAGCCCGGCTCGGTGCCGG GGG Intergenic
No off target data available for this crispr