ID: 1002139960

View in Genome Browser
Species Human (GRCh38)
Location 5:177132661-177132683
Sequence CCGGGGGTGGGCTCAGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139946_1002139960 19 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139960 5:177132661-177132683 CCGGGGGTGGGCTCAGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139960 Original CRISPR CCGGGGGTGGGCTCAGCGCT GGG Intergenic
No off target data available for this crispr