ID: 1002139962

View in Genome Browser
Species Human (GRCh38)
Location 5:177132670-177132692
Sequence GGCTCAGCGCTGGGGTCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139946_1002139962 28 Left 1002139946 5:177132619-177132641 CCGAGGTGCGGACGCGCTGTCAG No data
Right 1002139962 5:177132670-177132692 GGCTCAGCGCTGGGGTCGCCTGG No data
1002139955_1002139962 -2 Left 1002139955 5:177132649-177132671 CCCGGCTCGGTGCCGGGGGTGGG No data
Right 1002139962 5:177132670-177132692 GGCTCAGCGCTGGGGTCGCCTGG No data
1002139957_1002139962 -3 Left 1002139957 5:177132650-177132672 CCGGCTCGGTGCCGGGGGTGGGC No data
Right 1002139962 5:177132670-177132692 GGCTCAGCGCTGGGGTCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139962 Original CRISPR GGCTCAGCGCTGGGGTCGCC TGG Intergenic
No off target data available for this crispr