ID: 1002139971

View in Genome Browser
Species Human (GRCh38)
Location 5:177132702-177132724
Sequence CGCCCGGCCGTGGCCTCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002139971_1002139981 7 Left 1002139971 5:177132702-177132724 CCCGCGGAGGCCACGGCCGGGCG No data
Right 1002139981 5:177132732-177132754 CCGGGGCGGGTAACCCGACCCGG No data
1002139971_1002139979 -6 Left 1002139971 5:177132702-177132724 CCCGCGGAGGCCACGGCCGGGCG No data
Right 1002139979 5:177132719-177132741 CGGGCGAGCAGTGCCGGGGCGGG No data
1002139971_1002139978 -7 Left 1002139971 5:177132702-177132724 CCCGCGGAGGCCACGGCCGGGCG No data
Right 1002139978 5:177132718-177132740 CCGGGCGAGCAGTGCCGGGGCGG No data
1002139971_1002139976 -10 Left 1002139971 5:177132702-177132724 CCCGCGGAGGCCACGGCCGGGCG No data
Right 1002139976 5:177132715-177132737 CGGCCGGGCGAGCAGTGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002139971 Original CRISPR CGCCCGGCCGTGGCCTCCGC GGG (reversed) Intergenic
No off target data available for this crispr