ID: 1002145724

View in Genome Browser
Species Human (GRCh38)
Location 5:177179649-177179671
Sequence TGCTCATGAGAGCCCCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002145724_1002145726 19 Left 1002145724 5:177179649-177179671 CCTACAAGGGGCTCTCATGAGCA 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1002145726 5:177179691-177179713 TTTGAAAACTACCTCTGTGATGG 0: 1
1: 0
2: 2
3: 20
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002145724 Original CRISPR TGCTCATGAGAGCCCCTTGT AGG (reversed) Intronic
900212182 1:1461623-1461645 TCCTCATGAGACCCCCATGTAGG + Intronic
900212193 1:1461662-1461684 TCCTCATGAGACCCCCATGTAGG + Intronic
900212204 1:1461701-1461723 TCCTCATGAGACCCCCATGTAGG + Intronic
900212215 1:1461740-1461762 TCCTCATGAGACCCCCATGTCGG + Intronic
900224886 1:1528398-1528420 TCCTCATGAGACCCCCGTGTCGG + Intronic
900437958 1:2640469-2640491 TGCTCATCAGGGCCCCTCGGTGG + Intronic
901339075 1:8478775-8478797 TGCTCATTAGTGACCCTTGTGGG - Intronic
906687130 1:47770013-47770035 TGCTCCAGGGAGCCCCTTGGAGG - Intronic
906846870 1:49202052-49202074 TGCTAAGGAGAGCCCTTTGATGG - Intronic
908160327 1:61401665-61401687 TGCTGACAAGAGCCCCTGGTAGG - Intronic
910898906 1:92097993-92098015 TTCTGATGAGTGTCCCTTGTTGG - Intronic
914696238 1:150082987-150083009 TTCTCATGTCAGCTCCTTGTTGG - Intronic
918790195 1:188815078-188815100 TGCTCATCAGATACTCTTGTTGG + Intergenic
921124985 1:212169570-212169592 TTCCCCTGAGAGCCCCATGTCGG + Intergenic
921562829 1:216678999-216679021 TGCTCCTGAGACCGCCTTCTTGG - Intronic
1062980126 10:1715041-1715063 TGATGATAAAAGCCCCTTGTTGG - Intronic
1063027707 10:2198226-2198248 TAGTCATGAGAGCCCCTTGGGGG + Intergenic
1063131494 10:3181832-3181854 TGATAATGAGACCCCCTTCTTGG + Intergenic
1063231034 10:4065739-4065761 TGCTCATGACAGCAGCCTGTGGG - Intergenic
1065129407 10:22605301-22605323 TTCACATGAGAGCTCCCTGTTGG - Intronic
1066008023 10:31165905-31165927 TGCCCATGAGTTCCCCTTATGGG - Intergenic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1074706636 10:116138683-116138705 AGCTCATGAGAGACCATGGTGGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1078212531 11:9282025-9282047 TGCTTTTTAGAGCCCCTTGTGGG + Exonic
1083268052 11:61556077-61556099 GGCTCCTGAGGGCCCCTTGGAGG - Intronic
1083892815 11:65605309-65605331 TGCTTCTCAGAGCCCCTTCTGGG - Intronic
1084326162 11:68401399-68401421 TGCTCATCAGAACCGCCTGTTGG + Intronic
1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG + Intergenic
1097146706 12:56945504-56945526 TGCTCCTGAGAGACCAGTGTGGG - Intergenic
1099484595 12:83213077-83213099 TGCTCATGAGAAGCCCTGGTTGG - Intergenic
1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG + Intergenic
1103171710 12:118826147-118826169 TTCTCATGAGAGCCTCCTTTCGG + Intergenic
1111184683 13:84718176-84718198 TGCTCATGAGAGACACAAGTAGG + Intergenic
1113647737 13:112011046-112011068 TGCACATGGCAGCCCCTTGCTGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114210104 14:20606836-20606858 TGATTATGAGAGCCCATTGTAGG - Intronic
1116935662 14:50737397-50737419 TCCTCATGAGAGCCCTGAGTTGG + Intronic
1121309663 14:92929019-92929041 TGCCCAGGAAAGCCCATTGTTGG + Intronic
1122996335 14:105267230-105267252 GGCCCATGTGGGCCCCTTGTCGG - Intronic
1123164057 14:106309001-106309023 TGGTCCTGAGCGCCCCCTGTTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1127474883 15:59323835-59323857 TGCCCATAAGAGCCCCTGGGGGG + Intronic
1130784629 15:87082662-87082684 TGCTCTGGAGAGCTCCCTGTAGG - Intergenic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1142412210 16:89922677-89922699 CGCTCATGGCAGCCCCTTGGTGG + Intronic
1143833135 17:9668805-9668827 TGGCCATGAAAGCCGCTTGTAGG + Intronic
1144149068 17:12425836-12425858 TGCTCCTGAGGTCCCGTTGTTGG + Intergenic
1146563608 17:33892926-33892948 TGCTCCAAAGAGCCCCTTTTGGG + Intronic
1152215098 17:79027462-79027484 GGCTCATGAGAGCGGCTTGCTGG - Intronic
1153591684 18:6680769-6680791 TGCTCATCTCAGCCCCTTGATGG - Intergenic
1157880199 18:51314289-51314311 TGCACATTACAGCCACTTGTGGG + Intergenic
1161894910 19:7073016-7073038 TGCACAGGTGAGCCCCTGGTGGG - Intronic
1163529066 19:17839092-17839114 TGCTCATTAAAGCCCCCTGCAGG - Intronic
1167431053 19:49454595-49454617 GGATCATGAGAGCCCCGTGAAGG - Intronic
925847976 2:8050945-8050967 CGCTCATGAGATCTGCTTGTTGG + Intergenic
933167994 2:79096138-79096160 GGCTCATGAGAGCTGCTTGGGGG + Intergenic
934729848 2:96649634-96649656 TGCTCATGTGGGCCACCTGTAGG - Intergenic
937237044 2:120437288-120437310 TACTCATGCTGGCCCCTTGTGGG - Intergenic
944041647 2:195362370-195362392 TGATGATGAGAGCAACTTGTAGG + Intergenic
948499711 2:238382946-238382968 TGCTCCTGAAATCCCTTTGTTGG + Intronic
1168969345 20:1920107-1920129 TCCTCGTGTGAGCCCCTTTTAGG - Intronic
1171770389 20:29318928-29318950 CGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1174162495 20:48561615-48561637 TGCTTATGAGGACACCTTGTGGG - Intergenic
1175852348 20:62100314-62100336 TGCCCATGAGAGCCCCTGGGAGG - Intergenic
1177477662 21:21644898-21644920 TGCTCATGAGAACCTCTGCTAGG + Intergenic
1178070070 21:28955033-28955055 TCCTTATGTTAGCCCCTTGTTGG - Intronic
1180248897 21:46566463-46566485 TGTGCCTGAGAGCCCCTGGTTGG + Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180898940 22:19357145-19357167 TGCTCAGGGGAGGCCCTTGTTGG - Intronic
1181938657 22:26457793-26457815 TGCTCATGGGAACCACCTGTGGG - Intronic
1184342396 22:43893207-43893229 TTCTCATGTGAGCTCCTTGAGGG + Intergenic
1184614685 22:45630070-45630092 GGCTCATGAGAGCCCTTGCTTGG - Intergenic
949111474 3:266269-266291 TCCCCATCAGAGCCACTTGTAGG - Intronic
951109878 3:18790351-18790373 TGTTTATTAGAGCCCCATGTAGG - Intergenic
951699259 3:25478402-25478424 TGTTCTTGAGAGCCTGTTGTAGG + Intronic
958618238 3:96524251-96524273 AGTTCATGAGAGCCCCTTCGAGG - Intergenic
965508939 3:169547176-169547198 TTCTCATGAGATCCGGTTGTTGG + Intronic
965634368 3:170766500-170766522 TTCTCATGAGTGCTCCTTGAAGG + Intronic
968526446 4:1060233-1060255 TGCTCAAGAGAGCCAAGTGTGGG + Intronic
969787975 4:9473842-9473864 GGCTCTTGGGAGCCCCATGTCGG + Intergenic
969886957 4:10223418-10223440 TGCTCATGCTAGTCCCATGTGGG + Intergenic
980424528 4:132608943-132608965 TACTCATGGAAGCCCCTTCTTGG - Intergenic
982201479 4:152965764-152965786 TGCTCATGAGAACCAACTGTGGG - Intronic
984285968 4:177728938-177728960 TGCTCATGAGAGCATCTGTTAGG - Exonic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985651129 5:1108239-1108261 TGCTAAGGAGAGCCTCTTGCCGG + Intronic
986414202 5:7511865-7511887 AGATCATGAGAGACCCTTATTGG + Intronic
993269647 5:85777948-85777970 TTCTAATGAGAGCTCCTTGCAGG + Intergenic
995537172 5:113148369-113148391 TGCTCATGACATCCACCTGTAGG - Intronic
999125355 5:149242175-149242197 TGCTCAGCAGAGCCCCATGCAGG - Intronic
1001651510 5:173319264-173319286 GGCCCATGAGAGCCCATTGCTGG - Intronic
1002145724 5:177179649-177179671 TGCTCATGAGAGCCCCTTGTAGG - Intronic
1004460703 6:15833155-15833177 TCCTCATGACAGCCCCTTAAAGG + Intergenic
1006815854 6:36849356-36849378 TGCTGCTGACAGCCCCTTGGAGG + Intergenic
1007307894 6:40921449-40921471 TGCTGAGCAGAGCCCCTTGGAGG + Intergenic
1008136138 6:47779465-47779487 TGCTTATTAAAGCCCCTTGGGGG + Intergenic
1011124561 6:83993270-83993292 TTCTCATGACAACCCCTTGAGGG - Intergenic
1011483543 6:87819041-87819063 TCCTTATGAGAGGCCATTGTGGG + Intergenic
1018799232 6:167209944-167209966 TGCTCTGGAGGGTCCCTTGTCGG - Intergenic
1022562304 7:31362493-31362515 TACTCATGAGAGTCCCCTGAGGG + Intergenic
1023035426 7:36127373-36127395 TCCTCAGGAGAGCTCCTTCTGGG - Intergenic
1024608556 7:51043414-51043436 TCCCCAGAAGAGCCCCTTGTGGG - Exonic
1028464829 7:91139462-91139484 TGCTCCTCAGATCCCCTTGAAGG + Intronic
1030138389 7:106281363-106281385 TGGTCATGTGATCCCATTGTGGG - Intronic
1032500676 7:132397491-132397513 CACTCATGAGAGCCCCATGCTGG + Intronic
1033953578 7:146815919-146815941 TGCACATCAGGGCCCGTTGTGGG - Intronic
1045072879 8:98528742-98528764 TGCCCATCAGGGTCCCTTGTGGG - Intronic
1047364905 8:124202764-124202786 TGCTCATAAGAGCCTCATGAAGG - Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1057459186 9:95244210-95244232 TTCTCAGGAGAGCCCCTGCTGGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185663012 X:1742019-1742041 TGCTCTTGAGCTCACCTTGTAGG - Intergenic
1186715978 X:12251743-12251765 TGCTCATTAGAGCCCCTGCCTGG - Intronic
1187757595 X:22544841-22544863 TGCTCAAGAGAGGACCTTTTGGG + Intergenic
1190297810 X:49038842-49038864 GGCTCATGAGTGCCCCAAGTGGG - Intronic
1190383588 X:49862923-49862945 TGGTCATGAGAGACCTTGGTGGG - Intergenic
1190997086 X:55620348-55620370 TGGTAATGAGAGCCCCTTTAAGG + Intergenic
1195731543 X:107973309-107973331 AGATCATGAGAACACCTTGTAGG + Intergenic
1196234435 X:113262104-113262126 GGCTCAGGAGATCCCCTTGTGGG - Intergenic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic