ID: 1002146609

View in Genome Browser
Species Human (GRCh38)
Location 5:177188018-177188040
Sequence TCTTCCAGGCTTAGACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002146609_1002146614 29 Left 1002146609 5:177188018-177188040 CCTGCCAGTCTAAGCCTGGAAGA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1002146614 5:177188070-177188092 TCTCTTTTCCCAAGTGTCTTGGG 0: 1
1: 0
2: 3
3: 33
4: 323
1002146609_1002146613 28 Left 1002146609 5:177188018-177188040 CCTGCCAGTCTAAGCCTGGAAGA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1002146613 5:177188069-177188091 ATCTCTTTTCCCAAGTGTCTTGG 0: 1
1: 0
2: 1
3: 23
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002146609 Original CRISPR TCTTCCAGGCTTAGACTGGC AGG (reversed) Intronic
900557604 1:3288148-3288170 TCTGCCAGGCTAAGACCAGCTGG - Intronic
902983681 1:20142696-20142718 TATTACAGGCTGATACTGGCTGG - Intronic
904160701 1:28520231-28520253 TTTTTCAGCCTTAGTCTGGCAGG + Intronic
904213261 1:28899551-28899573 CCATCCAGGCTTAGGCTGGGGGG + Intronic
906129450 1:43447443-43447465 TCTTTAAGGCTCTGACTGGCAGG - Intronic
906945892 1:50293896-50293918 GATTCTAGACTTAGACTGGCTGG + Intergenic
910721142 1:90287412-90287434 TCTTCCAGGCTGAAAGTGGAAGG - Intergenic
910934970 1:92480258-92480280 ACTTCCAGGCAGAGAGTGGCTGG + Intronic
911299475 1:96154545-96154567 TTATCAAGGCTTTGACTGGCTGG - Intergenic
911884095 1:103275534-103275556 TCCTCCAGCCTCAGCCTGGCTGG + Intergenic
912194249 1:107378778-107378800 TCCTCCTGGCTCAGTCTGGCGGG + Intronic
912457738 1:109808908-109808930 TGTTCCAGGCTGAGCCTAGCTGG - Intergenic
919354963 1:196510392-196510414 GGCTCCAGGCTTAGACTGCCTGG - Intronic
920007791 1:202845955-202845977 TCTTCCAAGCTTAGACTCAGAGG + Intergenic
924171129 1:241342182-241342204 TCTTCAAGTCTTATACTGCCTGG + Intronic
924945852 1:248846586-248846608 TCTTCCAGCCCAAGTCTGGCTGG + Intronic
1063826488 10:9904259-9904281 TCTTCAAGGCTGACATTGGCAGG + Intergenic
1069663094 10:70136851-70136873 TGTTCCAGGCTGAGAGTGGCAGG - Intergenic
1071457066 10:85859062-85859084 TTTTCCAGGCATAGATAGGCAGG + Intronic
1072404697 10:95139325-95139347 TCTTCCTGGTTTAGACTGGGAGG - Intergenic
1074016438 10:109539302-109539324 TCTTCCTGGTTTAGACTTGGAGG + Intergenic
1076682568 10:132181400-132181422 ACTTCCAGGCTGAGAAGGGCCGG - Intronic
1079134403 11:17768255-17768277 TTTTCCAGACAGAGACTGGCAGG + Intronic
1081595189 11:44454082-44454104 TCTCCCAGGCTAAGCCTGGTGGG + Intergenic
1088137994 11:106580400-106580422 TCTTCCATGCTTCCACTAGCAGG - Intergenic
1091649834 12:2301727-2301749 TCCTTCAGGCTCAGTCTGGCAGG - Intronic
1092215631 12:6680066-6680088 TCTTCCAGGCTCAGCCTCCCAGG + Intronic
1094601931 12:31916441-31916463 TTTTCCAGGTTCAGATTGGCAGG + Intergenic
1097139772 12:56891331-56891353 TCTTCCTGGTTTAGTCTGGGAGG - Intergenic
1098432688 12:70437170-70437192 TGTTCTAGTCTTAGACTGGTGGG - Intergenic
1101800052 12:108013841-108013863 TCTTCCAGGACTAGTCTAGCTGG + Intergenic
1102024653 12:109707391-109707413 TCTCCCAGGCTGTGAGTGGCAGG - Intergenic
1103742345 12:123099388-123099410 TCTGCCAGGGCTTGACTGGCGGG + Intronic
1104016412 12:124965146-124965168 TCCCCCAGGCTTGGCCTGGCTGG - Intronic
1104271881 12:127289694-127289716 TCTTCCAAGCTGAGAACGGCAGG + Intergenic
1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1109375007 13:61481111-61481133 TCTTCCTGGCTCAGTCTTGCTGG + Intergenic
1111558647 13:89914093-89914115 TCTTCCAGCTTTATACTTGCAGG + Intergenic
1115020265 14:28671523-28671545 TATTCCAGGCTTAGGAAGGCAGG + Intergenic
1115342585 14:32308123-32308145 TCTTCCAGGCTGAAACAGGTTGG - Intergenic
1118301707 14:64622594-64622616 TCTCACATGCTTTGACTGGCAGG - Intergenic
1119110998 14:71973813-71973835 TCCCCCAGGATTAGACTTGCTGG + Intronic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1127090497 15:55462073-55462095 TCTTCCTGGCTTAATCTGGGAGG - Intronic
1133997117 16:10756857-10756879 TCCAGCAGGCTGAGACTGGCAGG - Intronic
1138245021 16:55460940-55460962 TCCTCCAGGCCTGGACTGGATGG + Intronic
1139400489 16:66677442-66677464 TCTGCCAGCCTCAGCCTGGCTGG - Intronic
1140495400 16:75382440-75382462 TCTGCCTGGCTTAGGCTTGCAGG + Intronic
1144711508 17:17404377-17404399 TCTGCCAGGCTGAGTCTTGCTGG + Intergenic
1148154592 17:45415669-45415691 TCTGCAAGGCTTAGGCTGGTCGG - Intronic
1148490195 17:48018486-48018508 TCTTTCATCCTTAGCCTGGCCGG - Intergenic
1149342698 17:55702863-55702885 TGTTCCTGGCTTGGACTGGGTGG - Intergenic
1152117529 17:78397759-78397781 GCTTCCAGGCTTGGAGTGGAGGG - Intronic
1153954219 18:10082536-10082558 TCATCCAGGCATGGGCTGGCTGG + Intergenic
1156628345 18:38937349-38937371 GTTTCCAGGCTGAGACTGGGAGG - Intergenic
1160305404 18:77729576-77729598 ACTTCCAAGCTCAGGCTGGCAGG + Intergenic
1164784469 19:30919198-30919220 TCTTCCAGCATCTGACTGGCTGG - Intergenic
1168658607 19:58148443-58148465 TTTTCCAGGTTCAGATTGGCAGG + Intronic
925994052 2:9277302-9277324 TCTTCCAGCCGCAGACTCGCGGG - Intronic
928601819 2:32910883-32910905 TCTTCCAGGCTGACTCTGGCTGG + Intergenic
931215098 2:60234670-60234692 ACTTCCTGGCTAAGAGTGGCTGG + Intergenic
932365957 2:71153769-71153791 ACTTCCAGGCTCAGGCTGCCTGG - Intergenic
933831664 2:86215888-86215910 TCTTCATGGGTTAGACTTGCTGG - Exonic
939163723 2:138618027-138618049 TCTTCCTAGCTTATCCTGGCTGG + Intergenic
941118921 2:161506051-161506073 TCTTCTTGGCTTAAACTGGAAGG + Intronic
942065499 2:172267414-172267436 TCTTCCTGGCTTAGTCTTGGGGG + Intergenic
945191125 2:207188542-207188564 TCTTCCAGGCTTAGAGTTTTGGG + Intergenic
1168972454 20:1939961-1939983 TCTTCCAGGCTTTGGCAGGAGGG - Intronic
1171224995 20:23435151-23435173 TCTTTCAGGCTTAGGCTAGGTGG + Intergenic
1171368546 20:24645028-24645050 TTTTCCAGGGTCAGACTGACCGG - Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1177241529 21:18464692-18464714 TCTTCCTGGTTTAGTCTTGCAGG - Intronic
1178010878 21:28285432-28285454 TCTCCCAGGGTTAGACTCCCAGG - Intergenic
1180193873 21:46182278-46182300 TCTTCCAGGCTGGTCCTGGCTGG - Intronic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1182418783 22:30238521-30238543 TCTCCCAGGCTGAGAGAGGCAGG + Intergenic
1183381924 22:37494422-37494444 TCCACCAGGCTCAGACGGGCTGG - Intronic
1184667719 22:45997414-45997436 TCTTTCAGGCTTAAAATGGCAGG - Intergenic
949564073 3:5229019-5229041 TCTTCCAACCTTAGGCTGGTAGG + Intergenic
951576818 3:24122875-24122897 TGTTCGAGGATTAGACTGACTGG - Exonic
955015182 3:55063339-55063361 CCTTCAAGGCTGAGACTGTCTGG - Intronic
957024044 3:75159456-75159478 TCTGCCAGGCTGAGGCGGGCAGG - Intergenic
961569063 3:127785257-127785279 TCTTCCCGGCCTGGTCTGGCCGG + Intronic
961693237 3:128685673-128685695 TCTTCCAGCTTTACACTGGCTGG - Intergenic
961723819 3:128912764-128912786 TCTTCCAGGTTTTGACCTGCAGG + Exonic
964543070 3:157801230-157801252 TCTTCCAGGTTTAGTCTTGAAGG + Intergenic
965146592 3:164913048-164913070 TCAGCCAGGGTTAGAGTGGCTGG + Intergenic
969152867 4:5185404-5185426 GTTTCTTGGCTTAGACTGGCAGG - Intronic
972150939 4:36090188-36090210 TCTTCCTGGTTTAGTCTGGGAGG - Intronic
977560966 4:98533395-98533417 TCTTCCTGGTTTAGACTTGTGGG + Intronic
982170250 4:152655238-152655260 CCTTCTTGGCTGAGACTGGCTGG + Intronic
987330457 5:16852591-16852613 TTTTCCAGGCCCAGACTAGCTGG + Intronic
987610213 5:20193368-20193390 TCTTCCTGGTTTAGTCTGGATGG - Intronic
992318521 5:75585571-75585593 TCTTCCAGCCTTTGCATGGCTGG - Intronic
994559249 5:101346663-101346685 TCTTCCTGGCCCAGAATGGCAGG - Intergenic
997843972 5:137269272-137269294 TCTTCCCTGCTTGGCCTGGCTGG - Intronic
998723842 5:144986147-144986169 TCTTCCTGGGTTAGACTTGGGGG + Intergenic
999097476 5:148992827-148992849 TCTTCCAGGATTAAACTGCTGGG + Intronic
1000924476 5:167177180-167177202 TCTTTTAGGCTTAGGCTGTCAGG - Intergenic
1001026646 5:168230151-168230173 TCTGCCAGGGTTAGATTTGCTGG + Intronic
1002146609 5:177188018-177188040 TCTTCCAGGCTTAGACTGGCAGG - Intronic
1002683495 5:180988666-180988688 ATTTTCAGGCTTAGTCTGGCAGG - Intergenic
1006276747 6:33010214-33010236 TCCTCCAGGCTGACACAGGCTGG + Intergenic
1006933482 6:37701407-37701429 TCTTCCAGGCTGTCACTCGCCGG - Intergenic
1009657349 6:66563939-66563961 TCATCAAGGCTTTGACTGGAAGG - Intergenic
1013587250 6:111590669-111590691 ACTGCCAGTCTTAGAGTGGCTGG + Intronic
1019764119 7:2837098-2837120 TCTTCCAGGCAGAGAATGGGAGG - Intronic
1020428931 7:8099556-8099578 TCTTCCTGGCTTAGACGTGGGGG - Intergenic
1021706185 7:23370324-23370346 ACTTCCATGCTTAAGCTGGCAGG + Intronic
1023868061 7:44248249-44248271 CCTTCCAGGCCATGACTGGCTGG + Intronic
1026290049 7:68998061-68998083 TCTTCCTGCCTTAGACTCCCAGG + Intergenic
1030908048 7:115211286-115211308 TCTTGCACTTTTAGACTGGCTGG - Intergenic
1031344920 7:120653064-120653086 TCAACCAGGCCTAGACTGGAGGG + Intronic
1031939442 7:127772201-127772223 TCTTACAGGCTTAGACCTGGAGG + Intronic
1033015562 7:137667762-137667784 TCTTCCTGGACTAGATTGGCTGG - Intronic
1033899394 7:146116695-146116717 TCTTCCGGGCTTGGAGCGGCAGG - Exonic
1038612069 8:29067135-29067157 TTTTCCAGACTGAGACTGGGAGG - Intergenic
1042105712 8:65324163-65324185 TGTTGCAGGCTGTGACTGGCTGG + Intergenic
1043343745 8:79274018-79274040 TCTTCCAGTTTTAGCCTGGCTGG - Intergenic
1046887165 8:119380089-119380111 TCTTCCTGGTTTAGACTTGGTGG - Intergenic
1048920959 8:139229628-139229650 TCTTCCTGACTTAGTCTAGCTGG - Intergenic
1052381250 9:27773391-27773413 TCTCCCATGCTCAGTCTGGCTGG + Intergenic
1053616813 9:39775728-39775750 TCTTCCAAGAATTGACTGGCAGG - Intergenic
1054236704 9:62566655-62566677 TCTTCCAAGAATTGACTGGCAGG + Intergenic
1054267355 9:62931710-62931732 TCTTCCAAGAATTGACTGGCAGG + Intergenic
1054550841 9:66601163-66601185 TCTTCCAAGAATTGACTGGCAGG + Intergenic
1055883954 9:81036857-81036879 TCTTCAAGCCTTAGAATAGCTGG - Intergenic
1057168522 9:92947123-92947145 TCCTCCAGGCTTAGAGAGGGTGG - Intergenic
1057859770 9:98631284-98631306 TTTTCCAGGGTCACACTGGCAGG - Intronic
1191788044 X:64938217-64938239 TCTTCCTGGTTTAGACTTGAGGG - Intronic
1194420223 X:93663889-93663911 TCTTCCTGGTTTAGTCTGGGAGG - Intergenic
1196067166 X:111477094-111477116 TCTTCAAGGCTGAGACAGGAGGG - Intergenic
1196935187 X:120723313-120723335 TCTTCCTGGCTTAATCTGGGAGG + Intergenic
1199170076 X:144725508-144725530 TCCTCCAAGCCTAGACTGCCAGG - Intergenic
1201543569 Y:15135740-15135762 TCTTCCTGGTTTAGACTTGGGGG - Intergenic