ID: 1002153757

View in Genome Browser
Species Human (GRCh38)
Location 5:177258447-177258469
Sequence CCTATATGCACAGACAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002153757_1002153759 9 Left 1002153757 5:177258447-177258469 CCAAAACTGTCTGTGCATATAGG 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1002153759 5:177258479-177258501 GTTTTGAAATGTGTTCTCTTTGG 0: 1
1: 0
2: 5
3: 44
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002153757 Original CRISPR CCTATATGCACAGACAGTTT TGG (reversed) Intronic
902992069 1:20195178-20195200 CCTTTATGTTCAAACAGTTTAGG + Exonic
904345059 1:29862443-29862465 CCTCTATGCAAAGCCAGTCTTGG + Intergenic
905010739 1:34745460-34745482 CCCAGATTCACAGACAGGTTAGG + Intronic
911266379 1:95749392-95749414 CCTATAATCACAGTCATTTTAGG + Intergenic
914392766 1:147236990-147237012 CCCCTTTGCACAAACAGTTTGGG - Intronic
915795029 1:158721077-158721099 CTTATATGAACACACAGATTTGG + Intergenic
921757358 1:218874319-218874341 CCTATATGCACAAGCATATTTGG - Intergenic
924096076 1:240552278-240552300 CCTATATAGAAAGACAGTTTTGG + Intronic
1062801971 10:387609-387631 CCTGTGTGGACAGACAGTGTGGG + Intronic
1062801979 10:387641-387663 CCTGTGTGGACAGACAGTATGGG + Intronic
1063300830 10:4847561-4847583 CCCAGATGCACAGACACTATTGG + Exonic
1064695363 10:17959676-17959698 CCTTTCTGCAGAGACAGTTGGGG - Intronic
1065793244 10:29281091-29281113 CCTTTAGGCACACACAGTTCAGG - Intergenic
1067004622 10:42649072-42649094 CCTATAAGCCAAGACATTTTTGG + Intergenic
1074145115 10:110710683-110710705 CCTATCTGCACAGAAAACTTTGG - Intronic
1074393798 10:113080097-113080119 CATACATGCACACACAATTTAGG + Intronic
1076495096 10:130891715-130891737 CATATATGCACGTACACTTTAGG - Intergenic
1076504806 10:130964549-130964571 GATATATTCACAGACACTTTGGG + Intergenic
1077966218 11:7136367-7136389 CAGATATGCACAGATAGTTTAGG - Intergenic
1080851610 11:36075041-36075063 ACTGTCTGCACAGCCAGTTTAGG - Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1088067875 11:105743047-105743069 CTTATATGCGCACCCAGTTTAGG - Intronic
1092179482 12:6435611-6435633 CCTATAGTCACAGATATTTTGGG + Intergenic
1092610583 12:10168144-10168166 CCTAAATTCACAGGCAGTTCAGG + Intronic
1093360064 12:18214194-18214216 ACTATGTCCACAAACAGTTTTGG + Intronic
1095946097 12:47754257-47754279 GCTATAGGCACAGACAGTAGAGG + Intronic
1097086869 12:56475321-56475343 CCTAGATGACTAGACAGTTTGGG - Exonic
1100234003 12:92639238-92639260 ATTGTTTGCACAGACAGTTTAGG - Intergenic
1102448702 12:113024313-113024335 CCGGTACACACAGACAGTTTGGG - Intergenic
1102668707 12:114599175-114599197 CCTATATCCACATAGACTTTTGG + Intergenic
1103524036 12:121555630-121555652 CCTATAATCTCAGACATTTTGGG - Intronic
1109800726 13:67374708-67374730 CAAATTTGCACAGACATTTTTGG - Intergenic
1114614240 14:24059828-24059850 CCTATTTGCACAGAAATTTTAGG + Intronic
1117835180 14:59797247-59797269 TCTATAAGCACAGAGAGTATGGG + Intronic
1119283378 14:73430176-73430198 CCTATATGCAAATGCAGTATAGG - Intronic
1120489120 14:85154201-85154223 CCAATAGGCACTGACAGGTTAGG - Intergenic
1121912134 14:97801427-97801449 GCTATGTGCAAAGACAGTGTTGG + Intergenic
1124807935 15:32905288-32905310 CCTATGTGCACATACACCTTAGG - Intronic
1125254117 15:37743381-37743403 CCTAGATGCAAATACATTTTGGG - Intergenic
1129707321 15:77802103-77802125 CCTATATGTACAGAGAGTGGGGG + Intronic
1131725806 15:95223347-95223369 CCTGAATGCAAAGACAGGTTAGG - Intergenic
1134774506 16:16840194-16840216 CCTATAATCACAGACAATTTAGG - Intergenic
1137803302 16:51280833-51280855 AATATATTCACAGACACTTTGGG + Intergenic
1139164595 16:64550990-64551012 CCTATAGGCCCAGACACTTTGGG + Intergenic
1140934906 16:79661421-79661443 CATTTAAGCACAGAGAGTTTAGG - Intergenic
1144609786 17:16700434-16700456 CACATTTGCACAAACAGTTTAGG + Intronic
1145129610 17:20331768-20331790 CACATTTGCACAAACAGTTTAGG + Intergenic
1146795499 17:35777421-35777443 CCTATATGCCCAGCCACTCTGGG - Intronic
1146939281 17:36832983-36833005 CATATATGCACAGATAGCTGTGG - Intergenic
1149127371 17:53251927-53251949 CCTTTCTGGACAGACACTTTGGG - Intergenic
1150586021 17:66518756-66518778 CCAAAATGCACACCCAGTTTAGG - Intronic
1152859324 17:82686490-82686512 CTTATAAGCACAGAGAGATTTGG + Intronic
1164953505 19:32360274-32360296 CCTATAAACACAGATAGGTTGGG - Intronic
1166773247 19:45297365-45297387 AATAGATGCACAGACATTTTTGG - Intronic
928268762 2:29835571-29835593 CTTATATCCACATACAGTCTGGG - Intronic
933462197 2:82602462-82602484 CATATATGCACTTAAAGTTTTGG + Intergenic
936721955 2:115262448-115262470 CCTGTATTCACTGACATTTTAGG - Intronic
940307889 2:152246110-152246132 CTTATAGGAAGAGACAGTTTTGG - Intergenic
942495543 2:176536161-176536183 CCTGACTGCACAGCCAGTTTAGG - Intergenic
943851378 2:192727454-192727476 TCTATATGCACACATGGTTTTGG - Intergenic
945443041 2:209903162-209903184 CTAAAATGCACAGACATTTTTGG - Intronic
948880259 2:240853201-240853223 CTTGTCTGCACAGACAGCTTAGG + Intergenic
1170281731 20:14656549-14656571 CCTATATGCACTGCCAGTTTTGG - Intronic
1170306429 20:14943670-14943692 TAAACATGCACAGACAGTTTTGG + Intronic
1172834389 20:37863681-37863703 CCTAGGTGCACAGTGAGTTTGGG + Intronic
1174144607 20:48442872-48442894 GCAATATTTACAGACAGTTTTGG - Intergenic
1174172518 20:48626282-48626304 TCTATATGCAGAGATGGTTTTGG + Intronic
1177341555 21:19809013-19809035 TCTATATGTACATACATTTTTGG + Intergenic
951183360 3:19684181-19684203 CCTAAAAGCAAAGAAAGTTTTGG + Intergenic
951978805 3:28543511-28543533 TCTATATGCACTGACATTTCAGG - Intergenic
961247709 3:125470776-125470798 CCTATTTGCACAGACCTGTTTGG - Intronic
962441127 3:135417115-135417137 CCTGTATGCACAGGCAGCTTTGG + Intergenic
962894905 3:139705326-139705348 CCAATATTCACTGACATTTTAGG + Intergenic
963599659 3:147367436-147367458 CCAAAATGCACAGACATTTAAGG + Intergenic
967216379 3:187214012-187214034 CCTAGAGAGACAGACAGTTTGGG - Intergenic
970130295 4:12862201-12862223 TGTATATGTACAGTCAGTTTGGG - Intergenic
971073634 4:23124011-23124033 TATATATGCATAGACAGCTTAGG - Intergenic
973653650 4:53023087-53023109 CCTTTGTGCATAGAGAGTTTAGG + Intronic
981436512 4:144729694-144729716 CCTTTATCCACAGACACATTGGG - Intronic
983444308 4:167829889-167829911 CTTATATGAACAGACTGTTGGGG + Intergenic
990833453 5:59986734-59986756 ATTATTTGCACAGACAGTTTAGG - Intronic
991458200 5:66827420-66827442 GATATATGCAAAGACCGTTTGGG + Intronic
991581261 5:68157447-68157469 GCAATATCCACAGACATTTTTGG - Intergenic
994274823 5:97822844-97822866 CCTAAGTACAAAGACAGTTTGGG + Intergenic
994497602 5:100533923-100533945 CCTCTCTGCACAGAAAGTTCTGG - Intergenic
994568070 5:101479315-101479337 CCAAAATTCACAGACAGTGTAGG - Intergenic
995941955 5:117597138-117597160 CTTATATGCAGAGACAGGTTTGG - Intergenic
999898532 5:156061787-156061809 CATAGATGAACTGACAGTTTGGG + Intronic
1000190619 5:158907010-158907032 CCTATGTGCCCAGATAGTCTAGG + Intronic
1002153757 5:177258447-177258469 CCTATATGCACAGACAGTTTTGG - Intronic
1003971836 6:11307553-11307575 CTTATAAGCACAGACACCTTGGG - Intronic
1004035679 6:11920721-11920743 CATATGTACACAGGCAGTTTTGG + Intergenic
1005434965 6:25799679-25799701 CTTATAGGCAGAGACAATTTTGG + Intronic
1011828698 6:91342034-91342056 CCTGTATGAACAGAAAGTTGTGG - Intergenic
1016144907 6:140657993-140658015 CTTATACACACATACAGTTTTGG + Intergenic
1016315582 6:142782400-142782422 CATATATGCTCAGAGAGTATGGG + Intronic
1024939727 7:54749889-54749911 TATATATGCACATACAATTTTGG + Intergenic
1027837111 7:83258565-83258587 CGTACATACACACACAGTTTTGG + Intergenic
1030793752 7:113761483-113761505 CCTACATGCACAGACAAACTAGG - Intergenic
1030956850 7:115863395-115863417 CCTAAATCCAGAGACAGTTGGGG - Intergenic
1032572071 7:133011103-133011125 GCTATAGGCACAAACAGGTTTGG + Intronic
1039713787 8:40087130-40087152 CATGGATGCACAGTCAGTTTAGG - Intergenic
1041414824 8:57596148-57596170 CCCATATGCACATACATATTTGG - Intergenic
1041451952 8:58015026-58015048 TCTTTATGCTCAGACAGCTTGGG + Intronic
1043991596 8:86762453-86762475 ACTGTTTGCACAAACAGTTTAGG + Intergenic
1045264872 8:100610422-100610444 CCCATATGCTCAGTAAGTTTTGG - Intronic
1049005228 8:139851116-139851138 CCTCTATTCACTGACAGGTTAGG - Intronic
1049187737 8:141267106-141267128 GCTATATGCGCACACAGATTTGG - Intronic
1050440945 9:5663506-5663528 CATATATGCACACACAGTATAGG - Intronic
1057107042 9:92429097-92429119 CCACTATTGACAGACAGTTTGGG - Intronic
1059375489 9:113877232-113877254 CCTAAAAGCAAAGTCAGTTTGGG + Intronic
1186218003 X:7320893-7320915 TCTATATGCACAGTCACTTAGGG - Intronic
1188408508 X:29842126-29842148 ACTGTCTGCACAAACAGTTTAGG + Intronic
1199256821 X:145726764-145726786 CTTGTATGCACAGACAGGGTTGG + Intergenic
1201851747 Y:18490926-18490948 CCTATGTACCCAGAGAGTTTTGG - Intergenic
1201881573 Y:18829454-18829476 CCTATGTACCCAGAGAGTTTTGG + Intergenic