ID: 1002154564

View in Genome Browser
Species Human (GRCh38)
Location 5:177266256-177266278
Sequence GGTGACCATCACCAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002154564_1002154569 -4 Left 1002154564 5:177266256-177266278 CCTTCCCCTTGGTGATGGTCACC 0: 1
1: 1
2: 1
3: 18
4: 262
Right 1002154569 5:177266275-177266297 CACCAAGTGGTCTAACTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002154564 Original CRISPR GGTGACCATCACCAAGGGGA AGG (reversed) Intronic
901769273 1:11522310-11522332 GGCTGCCATTACCAAGGGGAAGG - Intronic
902724769 1:18327492-18327514 GGTGTCCATCAACAGGAGGATGG + Intronic
902725366 1:18332210-18332232 GGTAACCACCACCTAGGTGATGG - Intronic
903534473 1:24057489-24057511 GGTCACCATCACCATTGAGAAGG - Exonic
904113065 1:28141758-28141780 AGTGTCCATCACCAAGGGAATGG + Intergenic
905559567 1:38915860-38915882 GGAAACCATCACAGAGGGGATGG - Intronic
905571717 1:39011547-39011569 GGTGACCGTCACCCATGGCATGG + Intergenic
905603170 1:39271398-39271420 CGAGAACAGCACCAAGGGGATGG + Intronic
905958662 1:42023570-42023592 GGAGAACAGCACCAAGTGGATGG - Intronic
906511749 1:46413975-46413997 GGTGCCCATCACCCACAGGAGGG + Intergenic
907294644 1:53442502-53442524 TGAGACCAGCACCGAGGGGATGG - Intergenic
908076753 1:60528204-60528226 TGAGACCATCACCAAGGGGATGG - Intergenic
908322376 1:62991046-62991068 GGGGACCATGACCAAGAAGAGGG - Intergenic
909531953 1:76691925-76691947 GGAGAACACCACCAAAGGGATGG + Intergenic
910575125 1:88753732-88753754 TGAGAACAGCACCAAGGGGATGG + Intronic
912183761 1:107249971-107249993 GGAGACTGTCACCATGGGGAAGG - Intronic
912260834 1:108110567-108110589 TGAGAACAGCACCAAGGGGATGG + Intergenic
912696843 1:111848454-111848476 GGAGATCAGCACCTAGGGGAGGG - Intronic
914904923 1:151736139-151736161 TGAGAACAGCACCAAGGGGATGG - Intergenic
918767122 1:188500445-188500467 TGAGAACAGCACCAAGGGGATGG - Intergenic
919580227 1:199363132-199363154 GGAGGACAGCACCAAGGGGATGG - Intergenic
919745173 1:201004311-201004333 GGTGACCAACACCCAGGGAAGGG - Intronic
919941361 1:202288757-202288779 GGTGACCTGGACCAAAGGGAGGG - Intronic
920631448 1:207656745-207656767 CGAGAACAGCACCAAGGGGACGG + Intronic
920641933 1:207760870-207760892 CGAGAACAGCACCAAGGGGACGG + Intronic
924654808 1:245964210-245964232 CCTGCTCATCACCAAGGGGAAGG + Intronic
1064262220 10:13795086-13795108 GGTGAACATCACCAGGGAGGTGG + Intronic
1064676958 10:17769991-17770013 GGGGACCATTACAGAGGGGAGGG - Intronic
1065250502 10:23806472-23806494 GAAGACCATCACCAAGGTAAAGG - Intronic
1069619760 10:69829638-69829660 GTTGACCATCACCTTGGAGAGGG + Intronic
1069739333 10:70677574-70677596 TCTGCCCCTCACCAAGGGGAGGG - Intronic
1069905276 10:71728601-71728623 GGTGACCAGCACTAAGGGAGGGG - Intronic
1070739131 10:78890927-78890949 GTGGAACATCACCCAGGGGAGGG - Intergenic
1072197099 10:93125675-93125697 GCTCACTATCACCAAGGGGATGG + Intergenic
1072296157 10:94011318-94011340 CATCACCATCACTAAGGGGATGG + Intronic
1073027785 10:100500841-100500863 GGTGAACATTTCCAAGGGAAGGG - Intronic
1074216943 10:111394383-111394405 TGAGACCACCACCAAAGGGATGG - Intergenic
1074497901 10:113996094-113996116 GGAGACCAGCCTCAAGGGGAAGG - Intergenic
1075421624 10:122305401-122305423 GGAGAACAGCACCAAGAGGATGG - Intronic
1075628611 10:123985232-123985254 TGAGAACAGCACCAAGGGGATGG + Intergenic
1075838487 10:125476790-125476812 TGAAAACATCACCAAGGGGAAGG + Intergenic
1076072176 10:127498885-127498907 GGTGTCCATCAACGAGGGAATGG + Intergenic
1076984618 11:226351-226373 GGTTCCCTTGACCAAGGGGAGGG + Intronic
1078757009 11:14220820-14220842 TGTGACCATCACCAAGATAATGG - Intronic
1081093154 11:38898070-38898092 TGAGAACAGCACCAAGGGGATGG - Intergenic
1081757736 11:45556634-45556656 AGTGACCTGCACTAAGGGGATGG + Intergenic
1083068053 11:59946011-59946033 TGAGACCAGCACCAAAGGGATGG + Intergenic
1083233316 11:61336843-61336865 GGTGACCAGCAGGAAGGGGTGGG - Intronic
1083998209 11:66282571-66282593 GGTGACGGTCGCCATGGGGACGG + Intronic
1084447956 11:69214901-69214923 GTTGACCATCACTGAGTGGAAGG - Intergenic
1085241788 11:75062562-75062584 TGAGAACAGCACCAAGGGGATGG - Intergenic
1085370050 11:75993975-75993997 ACTCACTATCACCAAGGGGATGG + Intronic
1086894100 11:92292405-92292427 GTTGAACATGACCATGGGGATGG + Intergenic
1086932659 11:92709504-92709526 GGTGACCTTCACTAAAGGTAGGG - Intronic
1089093765 11:115900675-115900697 GGTAACCATGACCATAGGGATGG + Intergenic
1090137258 11:124210605-124210627 GGGGACCACCACGAAGGGGCTGG - Intergenic
1092517256 12:9227504-9227526 TGAGAACACCACCAAGGGGATGG + Intergenic
1092811619 12:12276187-12276209 CAAGAGCATCACCAAGGGGATGG + Intergenic
1094102325 12:26777779-26777801 GGGGTCCTTCATCAAGGGGAAGG - Intronic
1095367995 12:41431011-41431033 GGAGAACAGTACCAAGGGGATGG + Intronic
1095601413 12:44017057-44017079 TGTCACTATCACCAAGGAGATGG + Intronic
1096256114 12:50063333-50063355 GCTGAGCAGCAGCAAGGGGAGGG + Intronic
1097065831 12:56319842-56319864 GGTAACCAAGACCAAAGGGATGG - Exonic
1099016377 12:77348464-77348486 TGAGAACAGCACCAAGGGGATGG + Intergenic
1102017160 12:109655603-109655625 GGTGACCTTCAGCAAGTGGGGGG - Intergenic
1102529784 12:113537822-113537844 CTTGCTCATCACCAAGGGGATGG + Intergenic
1104611428 12:130231740-130231762 GCTCATCATCACCAAGGGGATGG - Intergenic
1105730644 13:23211979-23212001 GGACAACAGCACCAAGGGGATGG - Intronic
1106284513 13:28307221-28307243 GGAGACCATGACCAAGGGCTGGG - Intronic
1106623157 13:31390611-31390633 GGTGCCCATAACCCAGGGGTTGG - Intergenic
1107950012 13:45453293-45453315 ACTCATCATCACCAAGGGGATGG + Intergenic
1109910423 13:68904288-68904310 GGAGAATATCACCAAGTGGATGG - Intergenic
1110276995 13:73651948-73651970 TGAGAACAGCACCAAGGGGATGG + Intergenic
1110411032 13:75204172-75204194 TGAGAACACCACCAAGGGGATGG + Intergenic
1110411300 13:75206186-75206208 CATGAACAGCACCAAGGGGATGG + Intergenic
1111968065 13:94881158-94881180 GGTGGCCATGATGAAGGGGAAGG - Intergenic
1113918146 13:113886912-113886934 GATGACCATCACGAGGGGAAAGG + Intergenic
1113925124 13:113937399-113937421 TGTTACCATAACCAAGGGAAAGG - Intergenic
1114244656 14:20901407-20901429 GGAGAACAGCACCAAGGGAATGG + Intergenic
1114247655 14:20929550-20929572 GGAGAACAGCACCAAGGGAATGG + Intergenic
1121019798 14:90572985-90573007 GGTGAAGCTCACCAAGGAGAAGG - Intronic
1121372810 14:93375748-93375770 CGGGAACAGCACCAAGGGGATGG + Intronic
1121549749 14:94789911-94789933 TGTGACCATCACCATGGCTATGG + Intergenic
1121693288 14:95893068-95893090 AGTGACCATGGCCAATGGGATGG + Intergenic
1122544790 14:102516521-102516543 GGTGACCATCAGAAGGGGTATGG + Intergenic
1123994632 15:25709950-25709972 GGAGACCATCACCGAGGAGCTGG + Intronic
1124781300 15:32637745-32637767 GGAGACCATCAGAAAGAGGAAGG + Exonic
1125450128 15:39799436-39799458 GGAGACCAACACAAAGAGGAAGG + Intronic
1128812217 15:70580907-70580929 GGTCACTATCAGAAAGGGGAGGG - Intergenic
1129055266 15:72815033-72815055 GGTGTCCATCACCAGGAGCATGG - Intergenic
1129133024 15:73517841-73517863 GGTGACCATAGCCTGGGGGAGGG + Intronic
1131934984 15:97493740-97493762 GATGACCCTCTCCAATGGGAGGG - Intergenic
1132135956 15:99338978-99339000 GGTGACTATCAGCAAGGAGGAGG + Intronic
1132194468 15:99901456-99901478 GGAGGCCAGCACCAAGAGGATGG - Intergenic
1132718503 16:1304199-1304221 GGTGACCACCACCAAGGAAGCGG + Intergenic
1132803706 16:1766227-1766249 GGCCACCATCGCCAACGGGAAGG + Exonic
1135151723 16:20012842-20012864 TGAGAACAGCACCAAGGGGATGG + Intergenic
1138030101 16:53553002-53553024 GCTGACCACCAGCAAGGAGACGG + Intergenic
1141345075 16:83237257-83237279 CGTGAGCATCACCATGGGGTGGG - Intronic
1143685082 17:8507374-8507396 TGGTACCATCACCAGGGGGAGGG - Intronic
1143982672 17:10883573-10883595 GGTGACCATGACCCAGGTGCCGG + Intergenic
1146946975 17:36880120-36880142 GGCAGCCCTCACCAAGGGGAAGG + Intergenic
1149195655 17:54116951-54116973 GGGCACCATCACCTCGGGGATGG - Intergenic
1149550385 17:57535231-57535253 AGTGACCCTCACAATGGGGAGGG - Intronic
1151045524 17:70916085-70916107 TGAGAACAGCACCAAGGGGATGG - Intergenic
1151269324 17:72981078-72981100 AGGCACAATCACCAAGGGGAAGG + Intronic
1151835378 17:76579483-76579505 CGTGACCCACACAAAGGGGAAGG - Intronic
1152750771 17:82061510-82061532 TGTGAACAGCACCATGGGGAGGG + Intronic
1154484552 18:14863314-14863336 CTTGCTCATCACCAAGGGGATGG - Intergenic
1159465928 18:68784369-68784391 TGAGAACAGCACCAAGGGGATGG + Intronic
1159871534 18:73763699-73763721 TGTGACCTAGACCAAGGGGATGG + Intergenic
1160721925 19:601448-601470 GGTGCCCATCACCAAACGGAGGG - Intronic
1163099020 19:15082362-15082384 GGATGGCATCACCAAGGGGAGGG - Intergenic
1165060470 19:33202708-33202730 GGTGGCCATGGCCAAGGGCAAGG - Intronic
1165361113 19:35337631-35337653 TGTGACCATCACCTGGGTGAAGG + Intronic
1167472586 19:49683928-49683950 GGTGACCATCATCAAGGGGAAGG + Exonic
1168493658 19:56832651-56832673 GGTCACCAACTTCAAGGGGAGGG + Intronic
926431961 2:12796533-12796555 GGTGACCATCACGATGATGATGG + Intergenic
928319586 2:30272485-30272507 GTTAACCAGCACCAAGGTGATGG + Intronic
928885714 2:36145997-36146019 GGTGACCAACATCAAGGTGGTGG + Intergenic
929095958 2:38263503-38263525 TGAGAACAGCACCAAGGGGATGG + Intergenic
929537289 2:42791798-42791820 GGTGACCATACCACAGGGGAGGG + Intronic
930600061 2:53432513-53432535 TGAGAACAGCACCAAGGGGATGG - Intergenic
931771019 2:65498161-65498183 GGTTACCATGGCCAAGGGGGAGG - Intergenic
932703513 2:74006377-74006399 GGTGAGGGTCACCAAGGAGATGG - Intronic
934677357 2:96259117-96259139 GGTGGACATCCGCAAGGGGAGGG - Intronic
935543393 2:104375803-104375825 GGAGAACATCTCCAAAGGGATGG + Intergenic
937216218 2:120315256-120315278 GGTGACCATCACCAGGGGCCAGG - Intergenic
938658522 2:133461577-133461599 GTTGACCATGTCCTAGGGGATGG - Intronic
940848879 2:158669886-158669908 GGTGAACATAACCAAAGGCAGGG + Exonic
946636886 2:221739138-221739160 GGAGAACAGCACCGAGGGGATGG + Intergenic
947587019 2:231362571-231362593 AGTGACTGACACCAAGGGGAGGG - Intronic
947965569 2:234278605-234278627 GGAGAACAGCACCAAAGGGATGG + Intergenic
948343613 2:237276819-237276841 GAAGAACAGCACCAAGGGGATGG + Intergenic
948527119 2:238577955-238577977 CTTACCCATCACCAAGGGGAAGG + Intergenic
1170511442 20:17081829-17081851 GGTGACTATCACTTATGGGAAGG - Intergenic
1171423087 20:25032080-25032102 GGGGACCATGGACAAGGGGAAGG + Intronic
1173020476 20:39263692-39263714 GGAGAACAGCACCAAGGGGATGG + Intergenic
1173110659 20:40185104-40185126 TGAGAACAGCACCAAGGGGATGG + Intergenic
1173433566 20:43012788-43012810 AATCACCATCACCATGGGGATGG + Intronic
1173548799 20:43917620-43917642 GGGGACAGTCGCCAAGGGGATGG - Intronic
1175096969 20:56548883-56548905 TGAGAACAGCACCAAGGGGATGG - Intergenic
1175805793 20:61828634-61828656 GGAGGCCATCAGCAAAGGGAAGG - Intronic
1178289016 21:31350531-31350553 CGAGAACAGCACCAAGGGGATGG - Intronic
1178320975 21:31605434-31605456 GGAGAACAGCACCAAGGGGATGG - Intergenic
1178520419 21:33284671-33284693 GGAGGACAGCACCAAGGGGATGG - Intronic
1178974930 21:37213365-37213387 GGTGACCATCAACAGATGGATGG - Intergenic
1179007313 21:37527224-37527246 GGTGAGAACCACCAAGAGGATGG + Intergenic
1179482321 21:41686021-41686043 GGTGACCATGACCATAGGCATGG - Intergenic
1179912920 21:44459819-44459841 GCAGACCTTCACCAAGGAGAAGG - Exonic
1180105803 21:45617361-45617383 GGTGACCCTGACCCATGGGAAGG + Intergenic
1180153576 21:45965860-45965882 TGAGAACAGCACCAAGGGGATGG - Intergenic
1182235362 22:28871002-28871024 GCAGAGCAGCACCAAGGGGATGG - Intergenic
1182466562 22:30520455-30520477 GGTGGCCCCCACCAAAGGGAGGG - Intergenic
1182672016 22:32004354-32004376 GGTTACCAGGACCTAGGGGAAGG - Intergenic
1182697476 22:32206561-32206583 GCTGCCCACCACCAGGGGGACGG - Intergenic
1183322989 22:37176436-37176458 GGTGACCAGCACCTGGGGGCTGG - Intergenic
1183342104 22:37287135-37287157 GGTGACCAATACATAGGGGATGG + Intronic
1183411645 22:37658556-37658578 CGTGGCCAACACCGAGGGGAAGG - Intronic
1183624986 22:38996398-38996420 GGTGGTCATCACAAAGAGGAGGG + Intergenic
1184754502 22:46508397-46508419 GATGACCACCACGCAGGGGACGG - Intronic
1184797973 22:46742711-46742733 GCTTACCAGCACCCAGGGGAGGG + Intergenic
1185132159 22:49045370-49045392 GGTGGCCGTGACCACGGGGACGG - Intergenic
949703848 3:6792460-6792482 TGAGAACATCACCAAGTGGATGG - Intronic
949823631 3:8141376-8141398 TGAGAACAGCACCAAGGGGATGG - Intergenic
950799814 3:15541275-15541297 TGTGAACAGCACCAAGGGGATGG + Intergenic
951191096 3:19772557-19772579 TGAGAACAGCACCAAGGGGATGG - Intergenic
951344444 3:21530016-21530038 AGTCACCCTCACCAAGGGGATGG - Intronic
951810026 3:26688665-26688687 TGAGAACAGCACCAAGGGGATGG + Intronic
953538369 3:43793163-43793185 GCTCTCCACCACCAAGGGGAGGG + Intergenic
953850695 3:46463829-46463851 GATGACCAACACCCATGGGAAGG + Intronic
954071626 3:48147036-48147058 GATGACCATCTCCAAGGTGCTGG - Intergenic
954130085 3:48556404-48556426 GGCCACCATCACCTCGGGGAGGG - Intronic
954370898 3:50169160-50169182 GGAGACCAGCAGCAAGGGGTAGG + Intronic
955551661 3:60091678-60091700 TGAGAACAGCACCAAGGGGATGG - Intronic
956321179 3:67998493-67998515 AGTGACCTTGACCAGGGGGAAGG - Intergenic
957694219 3:83613250-83613272 TGAGAACAGCACCAAGGGGATGG + Intergenic
960960152 3:123064992-123065014 AGTGACTATCACCTAGGGAAGGG - Intergenic
961371200 3:126433114-126433136 GATGTCCATCACCAAGGAGGAGG + Exonic
964176737 3:153832617-153832639 GGAGAACAGCACCAAGGGGATGG + Intergenic
964227753 3:154427850-154427872 GGAGCCCATCACCAAGGACAGGG - Intronic
964467989 3:157019432-157019454 GGTGGCCTTCACCAAGGAGATGG + Intronic
964672742 3:159244854-159244876 AGTGACCAGTCCCAAGGGGAAGG - Intronic
964718951 3:159752688-159752710 CGAGAACAGCACCAAGGGGATGG + Intronic
967350392 3:188508136-188508158 GGTGGCCATGACCATGGAGAAGG + Intronic
967575691 3:191088868-191088890 GGTGGCTATGACCAAGAGGATGG - Intergenic
968512713 4:1002623-1002645 GGACTCCTTCACCAAGGGGAGGG + Intronic
969095125 4:4727041-4727063 TGAGAACAGCACCAAGGGGACGG - Intergenic
969262950 4:6045103-6045125 TGGGACCATCCCCAAAGGGAGGG - Intronic
970987821 4:22178319-22178341 TCAGACCATCACCAAGGGGAGGG + Intergenic
971221110 4:24706685-24706707 GATGACCAACTCCAAGGTGAAGG - Intergenic
973736028 4:53872463-53872485 TGTGCCCATCACTGAGGGGAAGG - Intronic
975414538 4:74091859-74091881 CATAACCATCCCCAAGGGGAAGG - Intergenic
976985525 4:91291644-91291666 CGAGAACAGCACCAAGGGGACGG + Intronic
978918639 4:114154401-114154423 GCTGACAAGCACCAAGGGCAAGG - Intergenic
979253663 4:118590346-118590368 TGAGAACAGCACCAAGGGGATGG - Intergenic
980085346 4:128384759-128384781 TGTCACCATCACCAGCGGGAAGG + Intergenic
981409919 4:144417776-144417798 TGAGAACAGCACCAAGGGGATGG + Intergenic
981748633 4:148073272-148073294 GGTGGCCATCATCACGGGGCAGG - Intergenic
981776883 4:148378535-148378557 GGAGAACAGCACCAAAGGGATGG - Intronic
983823089 4:172221429-172221451 AATAACCATCAACAAGGGGATGG + Intronic
985704078 5:1390586-1390608 GGTGGCCACCCCCAAGGGTAAGG + Intergenic
986635885 5:9821980-9822002 AGTCACCATCAAGAAGGGGAAGG + Intergenic
986940674 5:12945590-12945612 GGAGGACAGCACCAAGGGGATGG - Intergenic
987463587 5:18245413-18245435 TGAGAGCAACACCAAGGGGATGG - Intergenic
988702181 5:33686237-33686259 GGGGACCGGCACCCAGGGGAGGG - Intronic
988718769 5:33854922-33854944 GTTGTCCCTCACCAGGGGGAGGG - Intronic
989639588 5:43570044-43570066 CATAACCATCCCCAAGGGGAAGG - Intergenic
990475502 5:56158245-56158267 GGTGACCATAGGCAAGGGGGCGG - Intronic
992448351 5:76853896-76853918 TGAGAACAGCACCAAGGGGATGG - Intronic
995860777 5:116638103-116638125 GGTGACAAACCCCAAGAGGAAGG - Intergenic
995909422 5:117167935-117167957 GTTCACTATCCCCAAGGGGATGG - Intergenic
997712439 5:136017220-136017242 GGGAACCATTACTAAGGGGAAGG - Intergenic
998442461 5:142173921-142173943 GGAGAACAGCACCAAGGGGATGG + Intergenic
999168709 5:149574489-149574511 GGTGAACACAACCAAGGGGCAGG - Intronic
1000106709 5:158066820-158066842 CTCGCCCATCACCAAGGGGATGG + Intergenic
1000668859 5:164034687-164034709 CTTACCCATCACCAAGGGGAAGG + Intergenic
1001419680 5:171577191-171577213 GCCTACCATCACCAAGGGAAAGG + Intergenic
1002154564 5:177266256-177266278 GGTGACCATCACCAAGGGGAAGG - Intronic
1003447682 6:6199867-6199889 GGTGGCCAGCACCATGGAGAGGG + Intronic
1003986920 6:11444465-11444487 TGAGAACAGCACCAAGGGGATGG + Intergenic
1004165740 6:13255248-13255270 GGAGAACAACACCAAGGGGAAGG + Intronic
1004166033 6:13257252-13257274 GGAGAACAGCACCAAGGGAATGG + Intronic
1004778861 6:18882270-18882292 CGAGAGCATCACCAAGAGGATGG - Intergenic
1005149294 6:22730315-22730337 TGAGATCAGCACCAAGGGGATGG - Intergenic
1005813333 6:29532135-29532157 TGAGACCCTCCCCAAGGGGATGG + Intergenic
1007535021 6:42579312-42579334 GGAGAACAGCACCAAGAGGATGG + Intronic
1007652852 6:43433936-43433958 GGGTACCTTCACAAAGGGGATGG + Intronic
1007793004 6:44324175-44324197 GGTGTCCATCAACAAAGGAATGG + Intronic
1008871639 6:56279101-56279123 GGAGATCAGCACCAAGAGGATGG - Intronic
1010009912 6:71037757-71037779 TGAGAACAGCACCAAGGGGATGG + Intergenic
1010536403 6:77036851-77036873 TGAGAACAGCACCAAGGGGATGG - Intergenic
1011172108 6:84516707-84516729 TGAGAACAGCACCAAGGGGATGG - Intergenic
1012230724 6:96758270-96758292 GGAGAACAGCACCAAGGGGATGG - Intergenic
1012918169 6:105193295-105193317 CTTGCTCATCACCAAGGGGAGGG - Intergenic
1013360991 6:109393781-109393803 GGTGACCATGCCAAAGGGTAGGG - Intronic
1014247862 6:119085943-119085965 TGAGAACAGCACCAAGGGGATGG + Intronic
1014415392 6:121177246-121177268 TGAGAACAGCACCAAGGGGATGG - Intronic
1015280936 6:131433454-131433476 TGGGAACAGCACCAAGGGGATGG - Intergenic
1016737062 6:147490545-147490567 GGTCACCAAGGCCAAGGGGAGGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019820841 7:3241653-3241675 CCTGACCATCACCCAGGTGAGGG + Intergenic
1020389260 7:7641046-7641068 GCTGCCCATCTCCAAGGGGGCGG - Exonic
1020616088 7:10464456-10464478 TGTGAACAGCACTAAGGGGATGG - Intergenic
1021767206 7:23961887-23961909 TGAGAGCAACACCAAGGGGATGG + Intergenic
1022440217 7:30426951-30426973 GGGTACTATCACAAAGGGGAAGG - Intronic
1027628907 7:80577832-80577854 GGTGACCATCACTGAAGGTATGG - Intronic
1028083681 7:86609989-86610011 AATGTCCATCACCAAGTGGATGG + Intergenic
1028626322 7:92881145-92881167 CGTGCCCACCACCCAGGGGATGG + Intergenic
1029335835 7:99898453-99898475 TGTAGCCATCCCCAAGGGGAGGG - Intronic
1030468866 7:109938277-109938299 GCTCACTATCACCAAGAGGATGG + Intergenic
1035057550 7:156046176-156046198 GGAGATCAGCACCGAGGGGATGG + Intergenic
1035770552 8:2143435-2143457 GGTGACCATCATGGAAGGGAAGG + Exonic
1036189621 8:6658542-6658564 GTTGATCATGACCATGGGGATGG - Intergenic
1037697147 8:21233536-21233558 AGAGACCAGCACCAAGGGGATGG - Intergenic
1038435766 8:27534950-27534972 TGTGACCTTCACCAAGAGCATGG - Intronic
1042893988 8:73645875-73645897 CGAGAACAGCACCAAGGGGATGG + Intronic
1043421323 8:80101752-80101774 CTTGATCATTACCAAGGGGAGGG + Intronic
1043651047 8:82592499-82592521 TGGAACCATCACCAATGGGAGGG - Intergenic
1045601340 8:103721066-103721088 GGAGAACAGCACCAAAGGGATGG - Intronic
1047128896 8:121995849-121995871 TGAGAACAGCACCAAGGGGATGG + Intergenic
1051189132 9:14492637-14492659 GGAGAATATCACCAAAGGGATGG + Intergenic
1051702672 9:19841315-19841337 GGATGCCATCACTAAGGGGATGG + Intergenic
1053417314 9:37954879-37954901 GATAACCATGGCCAAGGGGAGGG + Intronic
1053472185 9:38354810-38354832 CGAGAACAGCACCAAGGGGACGG + Intergenic
1056913573 9:90725634-90725656 GGTGACCATGGCCAAGAGCAGGG - Intergenic
1057961494 9:99461749-99461771 TGAGAACACCACCAAGGGGACGG - Intergenic
1058768930 9:108211625-108211647 TTTGGCCAGCACCAAGGGGAAGG - Intergenic
1060566823 9:124600097-124600119 GGTGACCATTCTCAAGGAGAGGG + Intronic
1060799906 9:126537244-126537266 GGTGACCAGGACCCAGGGAAGGG - Intergenic
1061224613 9:129273543-129273565 GCTGACCATCACCAAGTGATGGG - Intergenic
1062263411 9:135675086-135675108 AGTAGCCATCACGAAGGGGAGGG - Intergenic
1062333676 9:136055613-136055635 GATCACCACCAGCAAGGGGAAGG + Intronic
1062685300 9:137809577-137809599 GCTGACCATTCCCGAGGGGAAGG + Intronic
1185710942 X:2303372-2303394 CAAGAACATCACCAAGGGGATGG - Intronic
1187225560 X:17373093-17373115 GGGGACCACCACCAAAGGAAGGG + Intergenic
1190123974 X:47687069-47687091 GGTGTCCATCACCAAAAGAAGGG + Intergenic
1190145690 X:47889869-47889891 TGAGAACAGCACCAAGGGGATGG + Intronic
1190558914 X:51668208-51668230 GGAGAAAAGCACCAAGGGGATGG - Intergenic
1190565377 X:51725114-51725136 GGAGAAAAGCACCAAGGGGATGG + Intergenic
1193922186 X:87443292-87443314 GGGGAACATCACACAGGGGACGG - Intergenic
1193955173 X:87850979-87851001 GGTAACCATAACCAAGGAGAAGG - Intergenic
1196261136 X:113583031-113583053 ATTGTTCATCACCAAGGGGATGG + Intergenic