ID: 1002157463

View in Genome Browser
Species Human (GRCh38)
Location 5:177294408-177294430
Sequence CAGAGGTCTTTCCAGTGGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002157463_1002157477 28 Left 1002157463 5:177294408-177294430 CCCAACCACTGGAAAGACCTCTG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1002157477 5:177294459-177294481 CCATAGGTGCTGCCAGCCCAAGG 0: 1
1: 0
2: 0
3: 15
4: 178
1002157463_1002157472 -1 Left 1002157463 5:177294408-177294430 CCCAACCACTGGAAAGACCTCTG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1002157472 5:177294430-177294452 GGGGACGGCTGACCCAAGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 185
1002157463_1002157475 12 Left 1002157463 5:177294408-177294430 CCCAACCACTGGAAAGACCTCTG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1002157475 5:177294443-177294465 CCAAGGCTGGATAAATCCATAGG 0: 1
1: 0
2: 2
3: 6
4: 108
1002157463_1002157471 -5 Left 1002157463 5:177294408-177294430 CCCAACCACTGGAAAGACCTCTG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1002157471 5:177294426-177294448 CTCTGGGGACGGCTGACCCAAGG 0: 1
1: 0
2: 0
3: 21
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002157463 Original CRISPR CAGAGGTCTTTCCAGTGGTT GGG (reversed) Exonic
900600527 1:3500898-3500920 CAGAGGCCTCTCCAGGGGCTAGG + Intronic
900872720 1:5315842-5315864 CAGAGGTCTTTCCAGGATTTGGG - Intergenic
901231546 1:7644366-7644388 CAGAGATCTTTCCTGTCTTTTGG + Intronic
902948329 1:19860380-19860402 CAGAGGTCTTTCCAAAGGGTGGG + Intergenic
905622297 1:39458724-39458746 CAGTGGCCTTTCCATTGTTTTGG + Intronic
911269798 1:95787351-95787373 CAGATGTCTTTCAAGTGGAGAGG + Intergenic
912623726 1:111190954-111190976 CAGAAATCTTTCCAGTATTTGGG + Intronic
916977894 1:170101239-170101261 CAGATGGCTTGCCAGAGGTTGGG + Intergenic
918109588 1:181443723-181443745 CAGAGGTCTCTCCAATGGTGAGG + Intronic
918223319 1:182455928-182455950 CAGAGGTCTGGCCAATGGGTGGG + Intronic
920031666 1:203041144-203041166 CAGAGGTTTTTCCAGGGGGAGGG + Intronic
920685942 1:208109108-208109130 CAGAGGCCTTCTCAGTGGCTGGG + Intronic
1066046210 10:31597766-31597788 GTGAGGCCATTCCAGTGGTTGGG + Intergenic
1066251705 10:33639234-33639256 CAGAGGACTTTCAAGTCATTCGG - Intergenic
1067817778 10:49495648-49495670 CAAAATTCTTTCCATTGGTTTGG - Intronic
1067848007 10:49738295-49738317 CAGATGTCTTTCCCATGGTGGGG - Intronic
1069080062 10:64079123-64079145 AAGGGGTCTTACCAGTGGTCAGG + Intergenic
1071138741 10:82482359-82482381 CACAGGTCTTTGCAGTAGATGGG - Intronic
1072777324 10:98211857-98211879 TTCAGGTCTTTCCAGTGTTTAGG + Intronic
1073706447 10:105989613-105989635 CAAGGGACTTTCCTGTGGTTAGG - Intergenic
1077947727 11:6920328-6920350 CAGAAGTCTTTCCATTTGTGTGG + Intergenic
1080699101 11:34629203-34629225 CAGCCATCTTTCCAGTTGTTTGG - Intronic
1081695401 11:45105873-45105895 CAGAGGCCTCTCCAGGGGTGAGG + Intronic
1081700457 11:45149256-45149278 TAGAAGTCTTTCCAGTGTGTTGG + Intronic
1083131514 11:60628555-60628577 TAAAGGTCTGTTCAGTGGTTTGG - Intergenic
1083527318 11:63381271-63381293 CAGAGATATTTAAAGTGGTTAGG + Intronic
1085701693 11:78751725-78751747 CAGAGCTGTTTCCCGTTGTTGGG - Intronic
1086877406 11:92112893-92112915 CTGAGGTCTTTTCAGTGGGGAGG - Intergenic
1087007469 11:93483698-93483720 CAGAGCTCTTTCCAGTGTAAGGG - Intronic
1087322844 11:96684293-96684315 CAGGGGTCTTTACTCTGGTTTGG - Intergenic
1088627213 11:111737851-111737873 GCCAGGTCTTTCCTGTGGTTGGG - Intronic
1089673363 11:120072576-120072598 CAGAGCTCTTGCCAGTGTTCTGG - Intergenic
1089713377 11:120334127-120334149 CAAAGGTTTTCCCAGTGGATTGG + Intergenic
1091387713 12:105246-105268 GAGAGGTCTTTGGAGAGGTTGGG + Intronic
1109102192 13:58199458-58199480 CAGAGACCTTTGCAGGGGTTGGG + Intergenic
1110307644 13:74008356-74008378 CAGATGTGTTTCCAGTTGCTTGG - Intronic
1110731063 13:78878847-78878869 CAGCAGTCTTTCCTGGGGTTGGG + Intergenic
1112779199 13:102879573-102879595 CAGGGATCTTTCCAGTGGCATGG + Intergenic
1117530476 14:56656006-56656028 CAGAGTTCTTTCCAGAAGATAGG + Intronic
1118858098 14:69639590-69639612 AAAAAGGCTTTCCAGTGGTTTGG + Intronic
1119718115 14:76873123-76873145 GAGAGGTCTGCCCAGGGGTTGGG - Intergenic
1125864734 15:43035016-43035038 AAGAGGTCTTTCTAGTTGGTTGG - Intronic
1127067446 15:55255464-55255486 CAGTTGTCTGTCCAGTGGTGAGG - Intronic
1130108541 15:80946835-80946857 CAGAGGCCTGTCCAGGGATTCGG - Intronic
1130419819 15:83733920-83733942 CAGATGTCTATCCAGTGGGAAGG - Intronic
1136399089 16:30008127-30008149 CAGAGGTCTCTCCAGAGCCTGGG + Intronic
1142423503 16:89987888-89987910 CAGAGGTAATCCCAGTGCTTTGG + Intergenic
1143851235 17:9813607-9813629 CTGAGGTGTTTCCAGTGCTTTGG - Intronic
1144288998 17:13807379-13807401 CAGAGGGCTTTCCTGTGATGGGG - Intergenic
1146658680 17:34650249-34650271 CAGACAGCTTTCCAGGGGTTGGG + Intergenic
1148039003 17:44691137-44691159 AAGAGTTCTTGCCACTGGTTAGG - Intergenic
1148575739 17:48709717-48709739 CAAGGGTTTTTCCAGTGGCTGGG - Intergenic
1148822432 17:50367398-50367420 CCGAGGTCTTTGCAGTGGTAGGG - Intergenic
1150586354 17:66522084-66522106 CAGGGGTCTTTCTCTTGGTTTGG + Intronic
1150621313 17:66809750-66809772 AAAATGTCTTTCCTGTGGTTTGG - Exonic
1152792762 17:82290993-82291015 GAGGGGTCTTTTCAGTAGTTGGG + Intergenic
1153344656 18:4012398-4012420 CAGATGTTTTTGCAGTGGCTGGG - Intronic
1158779614 18:60631611-60631633 AGGAGGTCCTTCCAGTGGTCTGG + Intergenic
1160020883 18:75180037-75180059 CAAGGGGCTTTCCAGTGCTTAGG + Intergenic
1161627290 19:5334708-5334730 CAGAGCTCCTTCCAGGCGTTAGG + Intronic
1164832649 19:31334462-31334484 CTGAGGTCTTTTAAGTGTTTTGG + Intronic
1165994073 19:39832538-39832560 CAGAGGACTCTGCTGTGGTTTGG - Intronic
1166424480 19:42664186-42664208 CAGATTTCTTTCCATTGTTTTGG + Intronic
926214961 2:10900449-10900471 CAGAGCTCAGTCCTGTGGTTAGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929536254 2:42786227-42786249 CAGAGGTCTTCCCTGTGATGAGG + Intronic
932894599 2:75626612-75626634 CAGAGTTCTCTTCAGTGGTATGG - Intergenic
936250034 2:110861372-110861394 CATATGCATTTCCAGTGGTTTGG - Intronic
936755612 2:115706907-115706929 CAGACATCTTTCAAGTGGTGTGG + Intronic
940052465 2:149478973-149478995 CAAAAGTCTTTCAAGAGGTTTGG - Intergenic
942732043 2:179071090-179071112 CAGCAGTCATTCCAGTGGCTTGG + Intergenic
942791474 2:179766159-179766181 CAGAAGAACTTCCAGTGGTTAGG + Intronic
1168781351 20:493777-493799 CAGAGGGGTTGCCAGGGGTTGGG - Intronic
1173152203 20:40577179-40577201 CAAGGGTGTTTCCAGTGGATGGG + Intergenic
1173567855 20:44054637-44054659 CAGAGGTCTTTCCTGGGCTCAGG + Intronic
1180861749 22:19087169-19087191 CAGTGGGCTTCCCAGTGCTTGGG - Intronic
1181277110 22:21694184-21694206 CAGGGGTCTTTCCAGCGTTGTGG + Intronic
1184904703 22:47473108-47473130 CAGATGTGTTTCTTGTGGTTAGG - Intronic
950356290 3:12412705-12412727 CAGAAGTCCTTCCAGTGCTTGGG + Intronic
950426296 3:12926486-12926508 CCGAGGGCTGTCAAGTGGTTGGG + Intronic
952991766 3:38836691-38836713 CAGAGGACATTCCAGTGGAGGGG + Intergenic
954463863 3:50643258-50643280 CAGAGGTAGTGCCAGTTGTTGGG + Intronic
955005852 3:54967689-54967711 TTCAGGTCTTTCAAGTGGTTTGG + Intronic
958050906 3:88344661-88344683 CAGAGATCTTTCCAATGGAATGG - Intergenic
959830617 3:110857482-110857504 CAGGGGTCTCTCAAGTGGCTTGG - Intergenic
962746832 3:138402994-138403016 CAGAGGATTTTCCTATGGTTGGG + Exonic
962823279 3:139073907-139073929 CAAAGGGCTTTCCTGTGGCTAGG - Intronic
963492535 3:146019080-146019102 CAGTGGTGTTTGCAATGGTTCGG - Intergenic
965701078 3:171459968-171459990 CTGGTTTCTTTCCAGTGGTTTGG - Intronic
965839515 3:172887469-172887491 CAAGGGGCTTTCCAGTGGCTAGG + Intergenic
967699220 3:192571858-192571880 TAGAGGTCTTCCCAGAGCTTAGG + Intronic
968867010 4:3219511-3219533 GAGAGGGCTTTCCTGTGGTGAGG + Intronic
970418186 4:15879751-15879773 TAAATATCTTTCCAGTGGTTAGG + Intergenic
972028533 4:34419955-34419977 CAGAGGTCTTTCAAGTTCTGGGG + Intergenic
974775175 4:66471169-66471191 CAGATGTCTTTCCATTTGTTTGG + Intergenic
975645139 4:76538415-76538437 CAGATGTCCTTCCAGTACTTGGG - Intronic
975764418 4:77652180-77652202 GAGAAGCCTTTCCAATGGTTTGG - Intergenic
977181730 4:93883322-93883344 CAGACATATTTCCAGTGGTCTGG + Intergenic
978501125 4:109410913-109410935 CAGTGTTGTTGCCAGTGGTTTGG - Intergenic
978878249 4:113668292-113668314 CAGAGGTCTTTCCATTTCTCTGG - Intronic
979533693 4:121795855-121795877 CACAGGTGTTTCTTGTGGTTAGG - Intergenic
979600096 4:122577989-122578011 TAGAGGTCTCACCAGAGGTTAGG - Intergenic
982242985 4:153319311-153319333 CAGAGGTGTTTCCATTTGTTTGG - Intronic
982780220 4:159482687-159482709 CAGAGGTCTTTTCAGTCATGAGG + Intergenic
987720025 5:21621620-21621642 TAGAGCTCTTTCCTGTGGTTTGG - Intergenic
989452594 5:41604470-41604492 CTGATGTCTTCCAAGTGGTTAGG + Intergenic
990348770 5:54895029-54895051 CAGAGGGCTCTCCAGTTGTAGGG - Intergenic
990744857 5:58949581-58949603 CAAAGGACTCTCCAGTGGCTAGG - Intergenic
993514134 5:88808947-88808969 AAGAGGTTTTTACAGTAGTTAGG + Intronic
994042013 5:95269567-95269589 GATAGGTCTTTCCATTGTTTTGG - Intronic
994331481 5:98511715-98511737 CAGAGATTTTTTCAGAGGTTGGG - Intergenic
995886490 5:116900403-116900425 CAGAGATTTTTCAAGTGCTTGGG - Intergenic
996487724 5:124056495-124056517 CAGAGGTATTTTCAGTTGGTGGG + Intergenic
1002157463 5:177294408-177294430 CAGAGGTCTTTCCAGTGGTTGGG - Exonic
1005082199 6:21967449-21967471 CAGAGGTCTGTCTTGTGGTAGGG + Intergenic
1007544727 6:42684900-42684922 GAGAGGTGTTTCCAGTGGCAGGG - Intronic
1010541423 6:77096534-77096556 CCCAGGTCTTACCAGTTGTTAGG - Intergenic
1013687005 6:112596902-112596924 GAAAACTCTTTCCAGTGGTTAGG - Intergenic
1014036171 6:116769065-116769087 CACAGGGGTTTCCAGTGCTTGGG + Intergenic
1014079801 6:117272720-117272742 CACAGATATTTCCAGTGATTCGG - Exonic
1014445892 6:121526936-121526958 GAGAGGACTTTCCAAAGGTTAGG - Intergenic
1017684133 6:156895008-156895030 CAGTGGACTGTCCAGTGGTGTGG + Intronic
1020766608 7:12329696-12329718 AAGAGTTCTTTCCATTGTTTGGG + Intergenic
1023057363 7:36300824-36300846 CTGAGGTCTCTCCAGTGGGAGGG + Exonic
1023553314 7:41391997-41392019 CAGAGGCCTTTCCTCTGGCTGGG + Intergenic
1024967119 7:55033666-55033688 CAGACGTCCTTCCCGTGGTCTGG + Intronic
1029409549 7:100399903-100399925 GAGAGGGCTGTCCATTGGTTAGG - Exonic
1033592647 7:142825452-142825474 CAGAGCTTTTTACAGGGGTTTGG - Intergenic
1035050651 7:155997075-155997097 CAGAGGTCTGTCCAGTTCTGTGG - Intergenic
1035989449 8:4471896-4471918 CAAAGGTGTTTCCAATGATTAGG + Intronic
1036521654 8:9497265-9497287 GAGAAGTATTTCCAGTGGGTTGG + Intergenic
1039520741 8:38168939-38168961 CAGAAATCTTTAGAGTGGTTTGG - Intronic
1041408911 8:57532168-57532190 TAGATTTCTTTCTAGTGGTTTGG - Intergenic
1045395208 8:101753994-101754016 CACGGTTCTTACCAGTGGTTGGG - Intronic
1047022155 8:120786193-120786215 CAGAGGGATTTCCAGTAGTCTGG + Intronic
1047368835 8:124238144-124238166 CAGATGTCTCTCCAGCGGTATGG + Intergenic
1049720810 8:144114701-144114723 CAGAGGCCTTCCCAGTGGCAGGG - Intronic
1049865499 8:144932922-144932944 GACAGGACTTGCCAGTGGTTTGG - Intronic
1050540365 9:6664453-6664475 CAGAGCTATCTCCAGGGGTTGGG + Intergenic
1051715776 9:19982014-19982036 CTCAGGTTTTTCCACTGGTTTGG - Intergenic
1052713707 9:32089490-32089512 CAGACCTCTATGCAGTGGTTCGG - Intergenic
1052801291 9:32970563-32970585 CAGAGATCAGTCCAGTGGCTTGG - Intergenic
1055384113 9:75742590-75742612 CAGTGGTCTTTCCACTGCTCTGG - Intergenic
1061419136 9:130463823-130463845 CCCAGGTCTTGCCAGTGGCTGGG + Intronic
1061659477 9:132119243-132119265 CAGGGGTGTTTCTAATGGTTTGG + Intergenic
1187877021 X:23812765-23812787 CCGACGACTTTCCAGTTGTTTGG - Intergenic
1188552178 X:31376470-31376492 TAGAGGACTTTAAAGTGGTTGGG + Intronic
1194614913 X:96088167-96088189 CTGAGGTCTTTTCAGGGGTAAGG - Intergenic
1197269618 X:124411418-124411440 CATGGGTCTGTCCAGTTGTTGGG + Intronic
1197710924 X:129666582-129666604 TGGATGTCTTTCCACTGGTTTGG + Intergenic
1199321551 X:146445363-146445385 CAATGGTCTTTCTAGAGGTTGGG - Intergenic
1201938460 Y:19433066-19433088 CAGATGTCTTTCCTGCTGTTGGG + Intergenic