ID: 1002158770

View in Genome Browser
Species Human (GRCh38)
Location 5:177303008-177303030
Sequence GACTGTGACATTAGGTATTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002158770_1002158778 11 Left 1002158770 5:177303008-177303030 CCCAAATACCTAATGTCACAGTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1002158778 5:177303042-177303064 CGACATCACCTTGGCCACGAAGG 0: 1
1: 0
2: 1
3: 11
4: 545
1002158770_1002158779 14 Left 1002158770 5:177303008-177303030 CCCAAATACCTAATGTCACAGTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1002158779 5:177303045-177303067 CATCACCTTGGCCACGAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 127
1002158770_1002158775 2 Left 1002158770 5:177303008-177303030 CCCAAATACCTAATGTCACAGTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1002158775 5:177303033-177303055 GTCTCCGACCGACATCACCTTGG 0: 1
1: 0
2: 0
3: 3
4: 31
1002158770_1002158781 23 Left 1002158770 5:177303008-177303030 CCCAAATACCTAATGTCACAGTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002158770 Original CRISPR GACTGTGACATTAGGTATTT GGG (reversed) Exonic