ID: 1002158770 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:177303008-177303030 |
Sequence | GACTGTGACATTAGGTATTT GGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 147 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 137} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1002158770_1002158778 | 11 | Left | 1002158770 | 5:177303008-177303030 | CCCAAATACCTAATGTCACAGTC | 0: 1 1: 0 2: 0 3: 9 4: 137 |
||
Right | 1002158778 | 5:177303042-177303064 | CGACATCACCTTGGCCACGAAGG | 0: 1 1: 0 2: 1 3: 11 4: 545 |
||||
1002158770_1002158779 | 14 | Left | 1002158770 | 5:177303008-177303030 | CCCAAATACCTAATGTCACAGTC | 0: 1 1: 0 2: 0 3: 9 4: 137 |
||
Right | 1002158779 | 5:177303045-177303067 | CATCACCTTGGCCACGAAGGCGG | 0: 1 1: 0 2: 0 3: 8 4: 127 |
||||
1002158770_1002158775 | 2 | Left | 1002158770 | 5:177303008-177303030 | CCCAAATACCTAATGTCACAGTC | 0: 1 1: 0 2: 0 3: 9 4: 137 |
||
Right | 1002158775 | 5:177303033-177303055 | GTCTCCGACCGACATCACCTTGG | 0: 1 1: 0 2: 0 3: 3 4: 31 |
||||
1002158770_1002158781 | 23 | Left | 1002158770 | 5:177303008-177303030 | CCCAAATACCTAATGTCACAGTC | 0: 1 1: 0 2: 0 3: 9 4: 137 |
||
Right | 1002158781 | 5:177303054-177303076 | GGCCACGAAGGCGGCCCCGATGG | 0: 1 1: 0 2: 0 3: 19 4: 106 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1002158770 | Original CRISPR | GACTGTGACATTAGGTATTT GGG (reversed) | Exonic | ||