ID: 1002158771

View in Genome Browser
Species Human (GRCh38)
Location 5:177303009-177303031
Sequence GGACTGTGACATTAGGTATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002158771_1002158778 10 Left 1002158771 5:177303009-177303031 CCAAATACCTAATGTCACAGTCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1002158778 5:177303042-177303064 CGACATCACCTTGGCCACGAAGG 0: 1
1: 0
2: 1
3: 11
4: 545
1002158771_1002158779 13 Left 1002158771 5:177303009-177303031 CCAAATACCTAATGTCACAGTCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1002158779 5:177303045-177303067 CATCACCTTGGCCACGAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 127
1002158771_1002158775 1 Left 1002158771 5:177303009-177303031 CCAAATACCTAATGTCACAGTCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1002158775 5:177303033-177303055 GTCTCCGACCGACATCACCTTGG 0: 1
1: 0
2: 0
3: 3
4: 31
1002158771_1002158781 22 Left 1002158771 5:177303009-177303031 CCAAATACCTAATGTCACAGTCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002158771 Original CRISPR GGACTGTGACATTAGGTATT TGG (reversed) Exonic