ID: 1002158773

View in Genome Browser
Species Human (GRCh38)
Location 5:177303016-177303038
Sequence GGAGACCGGACTGTGACATT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002158773_1002158778 3 Left 1002158773 5:177303016-177303038 CCTAATGTCACAGTCCGGTCTCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1002158778 5:177303042-177303064 CGACATCACCTTGGCCACGAAGG 0: 1
1: 0
2: 1
3: 11
4: 545
1002158773_1002158779 6 Left 1002158773 5:177303016-177303038 CCTAATGTCACAGTCCGGTCTCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1002158779 5:177303045-177303067 CATCACCTTGGCCACGAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 127
1002158773_1002158786 30 Left 1002158773 5:177303016-177303038 CCTAATGTCACAGTCCGGTCTCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1002158786 5:177303069-177303091 CCCGATGGTCTGCAACGAGAGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1002158773_1002158775 -6 Left 1002158773 5:177303016-177303038 CCTAATGTCACAGTCCGGTCTCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1002158775 5:177303033-177303055 GTCTCCGACCGACATCACCTTGG 0: 1
1: 0
2: 0
3: 3
4: 31
1002158773_1002158781 15 Left 1002158773 5:177303016-177303038 CCTAATGTCACAGTCCGGTCTCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158773_1002158784 29 Left 1002158773 5:177303016-177303038 CCTAATGTCACAGTCCGGTCTCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1002158784 5:177303068-177303090 CCCCGATGGTCTGCAACGAGAGG 0: 1
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002158773 Original CRISPR GGAGACCGGACTGTGACATT AGG (reversed) Exonic