ID: 1002158776

View in Genome Browser
Species Human (GRCh38)
Location 5:177303037-177303059
Sequence GTGGCCAAGGTGATGTCGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002158776_1002158784 8 Left 1002158776 5:177303037-177303059 CCGACCGACATCACCTTGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1002158784 5:177303068-177303090 CCCCGATGGTCTGCAACGAGAGG 0: 1
1: 0
2: 0
3: 0
4: 36
1002158776_1002158781 -6 Left 1002158776 5:177303037-177303059 CCGACCGACATCACCTTGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158776_1002158791 28 Left 1002158776 5:177303037-177303059 CCGACCGACATCACCTTGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1002158791 5:177303088-177303110 AGGGAAGAGATCGGGGCCATAGG 0: 1
1: 0
2: 1
3: 12
4: 135
1002158776_1002158789 20 Left 1002158776 5:177303037-177303059 CCGACCGACATCACCTTGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1002158789 5:177303080-177303102 GCAACGAGAGGGAAGAGATCGGG 0: 1
1: 0
2: 0
3: 15
4: 204
1002158776_1002158788 19 Left 1002158776 5:177303037-177303059 CCGACCGACATCACCTTGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1002158788 5:177303079-177303101 TGCAACGAGAGGGAAGAGATCGG 0: 1
1: 0
2: 0
3: 23
4: 241
1002158776_1002158786 9 Left 1002158776 5:177303037-177303059 CCGACCGACATCACCTTGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1002158786 5:177303069-177303091 CCCGATGGTCTGCAACGAGAGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1002158776_1002158790 21 Left 1002158776 5:177303037-177303059 CCGACCGACATCACCTTGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1002158790 5:177303081-177303103 CAACGAGAGGGAAGAGATCGGGG 0: 1
1: 0
2: 1
3: 6
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002158776 Original CRISPR GTGGCCAAGGTGATGTCGGT CGG (reversed) Exonic