ID: 1002158777

View in Genome Browser
Species Human (GRCh38)
Location 5:177303041-177303063
Sequence CTTCGTGGCCAAGGTGATGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002158777_1002158791 24 Left 1002158777 5:177303041-177303063 CCGACATCACCTTGGCCACGAAG 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1002158791 5:177303088-177303110 AGGGAAGAGATCGGGGCCATAGG 0: 1
1: 0
2: 1
3: 12
4: 135
1002158777_1002158790 17 Left 1002158777 5:177303041-177303063 CCGACATCACCTTGGCCACGAAG 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1002158790 5:177303081-177303103 CAACGAGAGGGAAGAGATCGGGG 0: 1
1: 0
2: 1
3: 6
4: 158
1002158777_1002158781 -10 Left 1002158777 5:177303041-177303063 CCGACATCACCTTGGCCACGAAG 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158777_1002158784 4 Left 1002158777 5:177303041-177303063 CCGACATCACCTTGGCCACGAAG 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1002158784 5:177303068-177303090 CCCCGATGGTCTGCAACGAGAGG 0: 1
1: 0
2: 0
3: 0
4: 36
1002158777_1002158789 16 Left 1002158777 5:177303041-177303063 CCGACATCACCTTGGCCACGAAG 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1002158789 5:177303080-177303102 GCAACGAGAGGGAAGAGATCGGG 0: 1
1: 0
2: 0
3: 15
4: 204
1002158777_1002158786 5 Left 1002158777 5:177303041-177303063 CCGACATCACCTTGGCCACGAAG 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1002158786 5:177303069-177303091 CCCGATGGTCTGCAACGAGAGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1002158777_1002158788 15 Left 1002158777 5:177303041-177303063 CCGACATCACCTTGGCCACGAAG 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1002158788 5:177303079-177303101 TGCAACGAGAGGGAAGAGATCGG 0: 1
1: 0
2: 0
3: 23
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002158777 Original CRISPR CTTCGTGGCCAAGGTGATGT CGG (reversed) Exonic