ID: 1002158781

View in Genome Browser
Species Human (GRCh38)
Location 5:177303054-177303076
Sequence GGCCACGAAGGCGGCCCCGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002158776_1002158781 -6 Left 1002158776 5:177303037-177303059 CCGACCGACATCACCTTGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158777_1002158781 -10 Left 1002158777 5:177303041-177303063 CCGACATCACCTTGGCCACGAAG 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158773_1002158781 15 Left 1002158773 5:177303016-177303038 CCTAATGTCACAGTCCGGTCTCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158771_1002158781 22 Left 1002158771 5:177303009-177303031 CCAAATACCTAATGTCACAGTCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158770_1002158781 23 Left 1002158770 5:177303008-177303030 CCCAAATACCTAATGTCACAGTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158774_1002158781 1 Left 1002158774 5:177303030-177303052 CCGGTCTCCGACCGACATCACCT 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002158781 Original CRISPR GGCCACGAAGGCGGCCCCGA TGG Exonic
902869651 1:19306393-19306415 GGACACGAAGGCTGCTCAGATGG + Intronic
906636975 1:47416385-47416407 GGCGACGGCGGCGGCCCCGACGG - Exonic
914678641 1:149923556-149923578 GGCCTCGAAGTGGGCCTCGAGGG + Exonic
914902360 1:151717486-151717508 GGCCGCGGAGGCGGCGCCGCGGG + Intronic
1070766162 10:79057650-79057672 AGCCAGGAAGGCGGGCCCAAGGG - Intergenic
1072757570 10:98030866-98030888 GGCGGCGAAGGCGGCGGCGAGGG + Intergenic
1072784001 10:98268258-98268280 GGCCGCGGAGGAGGCCCCGCAGG + Intergenic
1076373923 10:129971389-129971411 GCCCCCGAGGGCGGCCCGGATGG - Intergenic
1079469605 11:20765680-20765702 GGCCAAGAAGGAGGCCAAGAAGG + Intronic
1083160793 11:60852952-60852974 GAGCGCGAAGGCGGCCACGACGG + Exonic
1083440358 11:62672079-62672101 GGCGGCGAAGGCGGCGCCGGCGG + Exonic
1090636934 11:128695087-128695109 TGCAACGGAGGCGGCTCCGAAGG - Intronic
1091749626 12:3014291-3014313 GGCCACACAGCCGGCCCCCAAGG - Intronic
1095450512 12:42326103-42326125 GGCCCCGAAGGCGGGCCCAGAGG + Exonic
1096403190 12:51324113-51324135 GGCCAGGGCGGCGGCCCCCAGGG - Exonic
1096868603 12:54579383-54579405 GGCCCAGGAGGAGGCCCCGAGGG + Exonic
1102463063 12:113112176-113112198 GCCCACGATGGCGTCCACGATGG + Exonic
1102899809 12:116627561-116627583 GGCCACGATGGCAGCCCCAGTGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1107951344 13:45465018-45465040 GGCCGCGAGGGCGGCGGCGATGG + Exonic
1113646054 13:111996799-111996821 AGCCACCAAGGCAGCCCCGGAGG + Intergenic
1119213346 14:72849476-72849498 AGGCAGGAAGGCGGCCCCGGGGG - Intronic
1122264099 14:100538670-100538692 GGCCGCGGTGGCGGCCCCGCTGG - Exonic
1124077746 15:26461917-26461939 GGCCATAAGGGCTGCCCCGATGG - Intergenic
1131257486 15:90871822-90871844 GGCCCCGGGGCCGGCCCCGAGGG + Intronic
1132870657 16:2114374-2114396 GGGCACGAAGGTGGCCACCAGGG + Exonic
1134521875 16:14922530-14922552 GGGCACGAAGGTGGCCACCAGGG - Intronic
1134709545 16:16321181-16321203 GGGCACGAAGGTGGCCACCAGGG - Intergenic
1134716758 16:16361210-16361232 GGGCACGAAGGTGGCCACCAGGG - Intergenic
1134950058 16:18347464-18347486 GGGCACGAAGGTGGCCACCAGGG + Intergenic
1134957994 16:18390949-18390971 GGGCACGAAGGTGGCCACCAGGG + Intergenic
1138805553 16:60085338-60085360 GCCCACGAAGGCAGCCGGGAGGG - Intergenic
1139418014 16:66830495-66830517 GGCCGCGAGGGCGGCACAGAGGG - Intronic
1142741918 17:1936529-1936551 GGCCAGGAGGGAGGCCCCCAGGG + Exonic
1143490641 17:7283558-7283580 GGCCACGGAGAGGGCCCAGAGGG - Exonic
1144028943 17:11302752-11302774 GGCCAAGAGGGCAGACCCGAAGG + Intronic
1145045849 17:19615135-19615157 GGTCAAGAAGGTGGCCCCAAAGG + Intergenic
1145281766 17:21473205-21473227 GGCCTCCAAGGCTGCCACGACGG - Intergenic
1145395674 17:22492418-22492440 GGCCTCCAAGGCTGCCACGATGG + Intergenic
1146935424 17:36809880-36809902 GGCCACGATGGGGGCACGGAGGG - Intergenic
1147486408 17:40819057-40819079 GGCCACGGCGGCGGCCACGGCGG - Exonic
1148371053 17:47100156-47100178 GGCAGAGGAGGCGGCCCCGAGGG - Intergenic
1151608310 17:75154181-75154203 CGGCACAAAGGCGGCGCCGACGG + Intronic
1151826669 17:76527705-76527727 GGCCACCAGGGCAGCCCCGGGGG - Exonic
1152566601 17:81103139-81103161 TGCCAGGAAGGCGCCCCAGATGG - Intronic
1153893055 18:9535930-9535952 GGCCACGCAGGCTGCTCAGATGG - Exonic
1157762859 18:50276884-50276906 GGTCAGGAAGGAGGCCCCGAGGG - Exonic
1160258207 18:77265405-77265427 AGCCATGAAGGCAGCCCGGAAGG - Intronic
1161460936 19:4397250-4397272 GGCCAAGACGACAGCCCCGAGGG + Intronic
1162021333 19:7869819-7869841 GGCTACGACAGCGGGCCCGAGGG - Exonic
1164855220 19:31515942-31515964 GGCCAGGACGGCGGCCTTGATGG + Intergenic
1165922641 19:39308311-39308333 GGCGACGATGACGCCCCCGATGG + Exonic
1166734496 19:45076131-45076153 GGCGAGGAGGGCGGCCCCGGCGG + Exonic
1167246007 19:48373629-48373651 GGCCAGGAAGCCGGCTCCCACGG - Exonic
1167386303 19:49166103-49166125 GGTCACCACGGCTGCCCCGAAGG - Exonic
1167427358 19:49436363-49436385 GGAAACGGAGGCGGCCCCTAAGG + Intronic
1168702929 19:58452169-58452191 GGTCCCGAAGGAGGCTCCGAGGG + Intronic
1168705420 19:58467691-58467713 GGTCCCGAAGGAGGCTCCGAGGG + Exonic
925881539 2:8357033-8357055 GGCAATGATGGCGGCCCAGATGG - Intergenic
934775311 2:96933577-96933599 GGGCACGAGGGAGGCCCAGAAGG - Intronic
935150131 2:100426657-100426679 GGCCACGGAGGCTGCTCAGATGG - Intergenic
938912437 2:135898140-135898162 GGCCTTGCAGGCGGCCGCGATGG - Intergenic
942692632 2:178602566-178602588 GGGCAAGAAGGTGGCCCCGGTGG + Exonic
945119619 2:206443936-206443958 GGCCCCCAACGCGGCCCCGCCGG + Exonic
947596151 2:231412859-231412881 GGCCCCTAAGGTGGCCCTGAGGG - Intergenic
948720712 2:239898389-239898411 AGTCAGGAAGGTGGCCCCGAGGG + Intronic
1171908765 20:30921999-30922021 AGGCACGAGGGAGGCCCCGAGGG - Intergenic
1175751868 20:61504188-61504210 GGCCACGGAGCCAGCCCCGTTGG - Intronic
1175871018 20:62209532-62209554 AGCCTCGAAGGCGGCCAGGACGG + Intergenic
1180093586 21:45544202-45544224 TGCCACGCAGGGGGACCCGAGGG - Intronic
1180843349 22:18969430-18969452 GGCCATGGAGGTGGCCCTGAGGG - Intergenic
1181058124 22:20269305-20269327 GGCCATGGAGGTGGCCCTGAGGG + Intronic
1181131110 22:20732898-20732920 TGCCACGTGGGCTGCCCCGAGGG - Intronic
1181514666 22:23403754-23403776 GGCCATGGAGGTGGCCCTGAGGG + Intergenic
1183471484 22:38009351-38009373 GGCCAGGAAGGAGGCCCCTGAGG + Intronic
1185169780 22:49286055-49286077 GGCCATGAAGGTGGCCCCCAGGG - Intergenic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
954873195 3:53783642-53783664 GGCCACGAAGGAAGTTCCGAAGG + Intronic
968907954 4:3463267-3463289 GGCCAGGAGGGCGGGCCCGCGGG - Intergenic
968998945 4:3964810-3964832 GGCCACGAAGGAGCCCACGAGGG + Intergenic
969360292 4:6658910-6658932 GGCCGCGGAGGCGGCGCGGATGG + Intergenic
970333413 4:15005126-15005148 AGCCAAGGAGGCGGCCCCGCGGG - Intronic
970441388 4:16083506-16083528 GGCCAGGGAGGCGGCGCAGATGG + Intronic
972301794 4:37791917-37791939 AGCCAAGAAGGAGGCCCAGAGGG + Intergenic
978617530 4:110611793-110611815 GGCCAAGAGGGCGACCCCGGAGG + Intergenic
981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG + Exonic
982389459 4:154848695-154848717 GCCCACGAAGGCAGCCAGGAGGG + Intergenic
987286950 5:16466209-16466231 GGCTCCGAGGTCGGCCCCGAGGG - Intergenic
987379879 5:17275447-17275469 TGCCAAGGAGGAGGCCCCGAAGG + Exonic
994823370 5:104681017-104681039 GGCCACGAAGGTAGCCAGGAGGG + Intergenic
1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG + Exonic
1003058250 6:2841857-2841879 GGTCAGGAAGGAGGCACCGAGGG + Exonic
1003397567 6:5766207-5766229 GGACAAGAAGCCTGCCCCGAAGG - Intronic
1006047134 6:31307862-31307884 GGCCACAAGGGAAGCCCCGATGG - Intronic
1015328522 6:131951128-131951150 GACCACGAAGGCGACGCGGACGG + Exonic
1017037420 6:150279216-150279238 GGTCACCAAGGCGGCCTCCACGG - Intergenic
1019288161 7:234054-234076 GGGCAGGAAGGCAGCCCCCAGGG - Intronic
1023049222 7:36236519-36236541 GGGCACTAAGGCAGCCCAGAGGG - Intronic
1029408155 7:100390220-100390242 GGCCACGAAGTCGGCCTCGGTGG - Intronic
1029640167 7:101815661-101815683 GGCCACAGACCCGGCCCCGAGGG - Intergenic
1030215944 7:107044444-107044466 GGACACGAAGGCGGCCTCGCTGG + Intergenic
1035048384 7:155983848-155983870 GGCCATGAAGTTGGCCCTGATGG + Intergenic
1035388453 7:158489838-158489860 GGCCAGGAAGGCAGCCTCGGGGG - Intronic
1035730841 8:1852798-1852820 TGCCACCAAGGCAGCCCCAATGG + Intronic
1037828962 8:22177152-22177174 GCCCACCAAGGCCGCACCGAGGG - Intronic
1039677361 8:39684454-39684476 GGGCACGAACTGGGCCCCGAGGG + Intronic
1042532652 8:69832035-69832057 GGCGAAGAGGGCTGCCCCGAAGG + Exonic
1042877985 8:73457367-73457389 GGCCAACAAGGCTGCCCCCAGGG + Intronic
1043891640 8:85656441-85656463 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043892712 8:85663278-85663300 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043895532 8:85735511-85735533 GGCCAAGGAGGCGGCCCCGGAGG + Intergenic
1043897147 8:85746297-85746319 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043899473 8:85764665-85764687 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043901081 8:85776858-85776880 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043903045 8:85792133-85792155 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043904655 8:85804326-85804348 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043906267 8:85816517-85816539 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1049438773 8:142599737-142599759 GGCCAAGGAGGCAGCCCCCAAGG + Intergenic
1049777463 8:144413301-144413323 GGACGCGAAGGCGGCGCCCACGG + Exonic
1055936831 9:81611787-81611809 GGCCACCACGGCGGCCGCGGCGG + Exonic
1057997164 9:99828783-99828805 GGCCAAGAGGGCGGCCCCGCTGG + Exonic
1060969144 9:127728200-127728222 GGCCTCGAAGGGGGCCCCAAGGG - Intronic
1060978413 9:127778835-127778857 GGCCAAGGAGGCGGCCCACAGGG - Intergenic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1061763768 9:132868740-132868762 GGCCAAGGAGGTGGCCCTGAAGG - Intronic
1203768158 EBV:37167-37189 GGCCACCATGGTGGCCCCGAGGG - Intergenic