ID: 1002158781

View in Genome Browser
Species Human (GRCh38)
Location 5:177303054-177303076
Sequence GGCCACGAAGGCGGCCCCGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002158773_1002158781 15 Left 1002158773 5:177303016-177303038 CCTAATGTCACAGTCCGGTCTCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158771_1002158781 22 Left 1002158771 5:177303009-177303031 CCAAATACCTAATGTCACAGTCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158776_1002158781 -6 Left 1002158776 5:177303037-177303059 CCGACCGACATCACCTTGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158774_1002158781 1 Left 1002158774 5:177303030-177303052 CCGGTCTCCGACCGACATCACCT 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158770_1002158781 23 Left 1002158770 5:177303008-177303030 CCCAAATACCTAATGTCACAGTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106
1002158777_1002158781 -10 Left 1002158777 5:177303041-177303063 CCGACATCACCTTGGCCACGAAG 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG 0: 1
1: 0
2: 0
3: 19
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002158781 Original CRISPR GGCCACGAAGGCGGCCCCGA TGG Exonic