ID: 1002160732

View in Genome Browser
Species Human (GRCh38)
Location 5:177312571-177312593
Sequence GGCAGATGGCAGGCAGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 427}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002160732_1002160739 -5 Left 1002160732 5:177312571-177312593 CCCAAGCCTGCCTGCCATCTGCC 0: 1
1: 0
2: 3
3: 43
4: 427
Right 1002160739 5:177312589-177312611 CTGCCCCCGAAGGCCCCCGTGGG No data
1002160732_1002160738 -6 Left 1002160732 5:177312571-177312593 CCCAAGCCTGCCTGCCATCTGCC 0: 1
1: 0
2: 3
3: 43
4: 427
Right 1002160738 5:177312588-177312610 TCTGCCCCCGAAGGCCCCCGTGG 0: 1
1: 0
2: 0
3: 22
4: 137
1002160732_1002160752 22 Left 1002160732 5:177312571-177312593 CCCAAGCCTGCCTGCCATCTGCC 0: 1
1: 0
2: 3
3: 43
4: 427
Right 1002160752 5:177312616-177312638 AGCTTCCTACTGTGTCGAATGGG 0: 1
1: 0
2: 0
3: 17
4: 210
1002160732_1002160751 21 Left 1002160732 5:177312571-177312593 CCCAAGCCTGCCTGCCATCTGCC 0: 1
1: 0
2: 3
3: 43
4: 427
Right 1002160751 5:177312615-177312637 CAGCTTCCTACTGTGTCGAATGG 0: 1
1: 0
2: 0
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002160732 Original CRISPR GGCAGATGGCAGGCAGGCTT GGG (reversed) Intronic
900145561 1:1157482-1157504 GGCCGATGGGAGGCAGGGCTGGG - Intergenic
900265632 1:1755750-1755772 GGCGGGTGGGAGGCAGCCTTGGG + Intronic
900316752 1:2060812-2060834 GGCAGGGGGCGGGGAGGCTTTGG + Intronic
900342091 1:2194261-2194283 GGGAGGTGGCCGGCAGGGTTGGG + Intronic
900376183 1:2355900-2355922 GGAAGATGTGAGGGAGGCTTTGG + Intronic
900598138 1:3491701-3491723 GGGAAGTGGGAGGCAGGCTTGGG - Intronic
900825206 1:4920832-4920854 GGCAGGTGGGAGCCAGGATTAGG - Intergenic
900836173 1:5006003-5006025 GGCAGATAGCTGGCAGGCCACGG - Intergenic
901061581 1:6474251-6474273 GGGGGAGGGCAGGCAGGCCTTGG - Intronic
901357435 1:8663573-8663595 GACAGATGGGAGGAAGGCTAAGG - Intronic
902715539 1:18270197-18270219 AGTGGATGGCAGGCAGGGTTGGG - Intronic
903213001 1:21829084-21829106 GGAGGATGCCAGGCAGGGTTGGG + Intronic
904187746 1:28719158-28719180 ACCATATGGCAGGAAGGCTTTGG - Intronic
904832921 1:33316758-33316780 CCCAGAAGGCAGGCAGGCTCAGG + Intronic
904864958 1:33571056-33571078 TGGAGAAGGCAGGCAGGTTTAGG + Intronic
905003227 1:34689759-34689781 TACAGAGAGCAGGCAGGCTTGGG - Intergenic
905250507 1:36645282-36645304 GCAAGATGGTAGGCAGACTTTGG - Intergenic
905387781 1:37616163-37616185 AGGAGATGACAGGCAGGCTTTGG + Intronic
905427031 1:37894192-37894214 AGCAGATGGCAGGCTGGATTTGG + Intronic
906246170 1:44275818-44275840 GGAAGCAGGCAGGCAGCCTTAGG - Intronic
906286122 1:44588930-44588952 GGCACATGACAGGCAGGGTGAGG - Intronic
907246684 1:53113561-53113583 GGCAGATGGCAGGGCTGCTCAGG - Intronic
907518263 1:55007048-55007070 GGCTGAAGTCAGGCAGGCTCTGG - Exonic
908931026 1:69315954-69315976 GGCAGGTGGCTGTCAGGCTCTGG + Intergenic
909409550 1:75334028-75334050 GGCAGATGGCAGGTAAGAGTTGG - Intronic
911323326 1:96440534-96440556 GGCAGATAGGAGGCAGGACTAGG - Intergenic
912708721 1:111934175-111934197 GGGAGGTGGGAGGCAGGGTTGGG + Intronic
912905895 1:113706923-113706945 GGCAGATGGGAGGATTGCTTGGG - Intronic
913233899 1:116764209-116764231 GGCAGTGGGCAGGCCGGCCTTGG + Intronic
914411636 1:147434874-147434896 GGCAGCAGGAAGCCAGGCTTTGG - Intergenic
915127650 1:153677386-153677408 TTGAGATGGCAGGCATGCTTTGG - Intergenic
915475665 1:156151338-156151360 GGGAGATGGCAGTGGGGCTTGGG + Intronic
915525830 1:156475772-156475794 TGGAAAAGGCAGGCAGGCTTTGG - Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
915943729 1:160135314-160135336 GGCAGATGACAGGCAGGGACCGG + Intronic
917113250 1:171574573-171574595 GGCAAATGGCAGGCATCTTTTGG - Intronic
917441316 1:175071382-175071404 GGCAGATGGCATCCAAGCCTTGG - Intronic
917633042 1:176908548-176908570 GGCACAAGGCAGTCAGCCTTGGG + Intronic
919249182 1:195030654-195030676 GGCAGGAGGCAGACAGGCTCTGG - Intergenic
919661430 1:200251681-200251703 GGGGGCTGGCAGGCTGGCTTGGG - Intergenic
920695237 1:208176820-208176842 AGCAGCTGACAGGCAGGCTAGGG - Intronic
921721100 1:218472298-218472320 GGCAGATGACAGGCTGGATTTGG - Intergenic
922613019 1:226944006-226944028 TGCAGATGGCAGGGAGGCAGGGG + Intronic
922767131 1:228162047-228162069 AGCAGATGGCGTGGAGGCTTGGG - Intergenic
922903600 1:229157219-229157241 TGCAGAAGGCAGGCAGGGTGAGG + Intergenic
922925319 1:229342745-229342767 GGCGGAAGGCAGGGAGGCTGCGG + Intronic
923668325 1:236018468-236018490 CTCAGATGGCCGCCAGGCTTTGG + Intronic
924613380 1:245591892-245591914 TGCTAATGGCCGGCAGGCTTGGG - Intronic
924820322 1:247483614-247483636 AGCAGTTGGCAGATAGGCTTAGG + Intergenic
1065799788 10:29341732-29341754 GGCAGAAGGCAAGAAGGCATAGG - Intergenic
1067393638 10:45889947-45889969 GGCAGCTGACATGCAGGCTGAGG + Intergenic
1067758587 10:49025868-49025890 GGCAGATGGAACACAGGGTTTGG - Intronic
1067861963 10:49859102-49859124 GGCAGCTGACATGCAGGCTGAGG + Intronic
1069783173 10:70969516-70969538 GGCTGACAGCAGGCAGGCTGGGG + Intergenic
1070481165 10:76884185-76884207 GGCAGCTGGCAGGAAAGATTTGG + Intronic
1072306594 10:94113753-94113775 GGCAGTGGGCAGGGAAGCTTGGG + Intronic
1072764353 10:98083678-98083700 GTGAGGTGGCAGGCAGGCATGGG - Intergenic
1073760175 10:106620659-106620681 GGAATATGGCAGCCAGGTTTTGG - Intronic
1075346060 10:121682675-121682697 GGCAGAGGGGAGGCAGCTTTCGG - Intergenic
1075729760 10:124629167-124629189 AGCACATGCCAGGCAGGCTGGGG - Intronic
1075745586 10:124725110-124725132 GGGAGGTGACGGGCAGGCTTTGG - Intronic
1076517555 10:131056716-131056738 GGCAGGTGACCTGCAGGCTTTGG + Intergenic
1076854855 10:133111105-133111127 GGCAGGTGGCCAGCAGGATTAGG - Intronic
1077015976 11:399369-399391 GGCAGATGGCGGGCAGGTGGGGG - Intronic
1077360749 11:2139293-2139315 GGCAGAGCGCGGGCAGGCGTGGG + Intronic
1077384109 11:2260982-2261004 GGCAGCTGGCAGGCTGGCATGGG - Intergenic
1077436111 11:2539996-2540018 GGCCGGGCGCAGGCAGGCTTGGG + Intronic
1078450467 11:11437061-11437083 GGCAGAGGGGAGGGAGGCTCTGG - Intronic
1079323025 11:19467992-19468014 GGCATAAGGAAGGGAGGCTTGGG + Intronic
1079730351 11:23933185-23933207 GACAGACAGCAGGCAGGATTTGG - Intergenic
1080005871 11:27405769-27405791 GGCAGATGGGAGGCAGGGATAGG - Intronic
1080016270 11:27510014-27510036 GGTAGTTTGCTGGCAGGCTTTGG + Intergenic
1080301162 11:30786316-30786338 GGCAGATGGCAGGAAGCCTTAGG - Intergenic
1081813466 11:45926118-45926140 GTGAGGTGGCAGGCAGGCTAAGG - Exonic
1082261227 11:50077435-50077457 GGCCGATGGGAGGCAGGAGTTGG + Intergenic
1082317801 11:50750834-50750856 GCAAGATGGCAGTGAGGCTTGGG - Intergenic
1083173533 11:60936219-60936241 GGCAGGTGGCAGGCAGTGTCGGG + Exonic
1083224013 11:61273388-61273410 GGGTGATGGCAGGCAGCCTGCGG - Intronic
1083464042 11:62833522-62833544 GGCAGCTGGAATGCAGACTTGGG - Intronic
1083611015 11:64004308-64004330 GGCGGAAGGCAGGCAGGCTCCGG + Intronic
1083810806 11:65105663-65105685 GCCTGAAGGGAGGCAGGCTTGGG - Intronic
1083856596 11:65396171-65396193 GGCAGGAGGCAGGAAGGGTTGGG + Intronic
1085135892 11:74087693-74087715 GTGAGATGGCAGAAAGGCTTGGG + Intronic
1085391834 11:76186073-76186095 GGCAGCTGGGATGCAGACTTCGG - Intergenic
1085524733 11:77157591-77157613 CGCACACGGCAGGCTGGCTTGGG + Intronic
1086085116 11:82945737-82945759 GGCAGAAGGCAGACAGGATCTGG - Intronic
1088820426 11:113452032-113452054 GGCTGCTGGCAGGCAGGCTGGGG - Intronic
1089525484 11:119094357-119094379 GGCCGCTGGCCGGGAGGCTTTGG - Exonic
1090684526 11:129100652-129100674 GGCAGGGTGCAGGCAGGGTTGGG - Intronic
1091223548 11:133944863-133944885 GGCAGAGGGAAGGCAGGCTGGGG + Intronic
1091277704 11:134363444-134363466 GGCAGATAGCAGGCAGGTGAGGG + Intronic
1091322338 11:134660658-134660680 GGCAGATTCCCTGCAGGCTTAGG + Intergenic
1091642656 12:2249290-2249312 AGCAGATGGCAGGCCGGATGTGG - Intronic
1091882183 12:3988984-3989006 AGAAGATGGAAGGCAGGGTTTGG - Intergenic
1092022321 12:5212754-5212776 TGCAGAGGGCATGCTGGCTTTGG + Intergenic
1092063580 12:5570988-5571010 AGCAGATGGGAGGCAGCCATGGG + Intronic
1092077100 12:5683033-5683055 GGCAGAGAAGAGGCAGGCTTGGG - Intronic
1092953097 12:13526052-13526074 GGGAGATGGAATGCAGGCATGGG + Intergenic
1096552224 12:52380594-52380616 GGCAGTTTGCAGGTAGGCTTCGG + Intronic
1097029681 12:56081668-56081690 GGCAGGAGGCAGGCATGGTTGGG + Intronic
1097152974 12:56993401-56993423 GGCAGATGGCAGAGTGGCCTAGG - Intergenic
1097173441 12:57129508-57129530 GGCAGAGGGCAGGCAGGCCCGGG + Intronic
1098110217 12:67113661-67113683 GACTGATGCCAGGCAGGGTTAGG + Intergenic
1099577752 12:84402877-84402899 GGCTGATGGCAGCCTGGGTTGGG - Intergenic
1100883063 12:99039634-99039656 GCCAGAGGGAAGGCAGGCTTGGG - Intronic
1101086142 12:101238983-101239005 TGCAGATGGCAGGCAGCCTGGGG + Intergenic
1101371723 12:104137595-104137617 GGCGGGTGGGAGGCAGGCGTTGG - Intronic
1101585474 12:106081859-106081881 GGCAGGTGGCAGGAAGGATCTGG + Intronic
1101867138 12:108528578-108528600 GGAAGAAGACAGGCAGGCATGGG + Intronic
1102094336 12:110224213-110224235 GGCGTATGGCAGCCAGGCCTGGG + Intergenic
1102661327 12:114531420-114531442 GGCTGTTGGCAGGCAGGATTTGG - Intergenic
1102790436 12:115639835-115639857 GGGAGAGGGCAGGCAGGAATTGG - Intergenic
1102942364 12:116954799-116954821 GGAAGATGGCAGGGATGGTTTGG - Intronic
1103966831 12:124645538-124645560 GGCAGACGAGAGTCAGGCTTAGG - Intergenic
1104050309 12:125190100-125190122 GGCAGATGGGAAGGAGACTTGGG + Intronic
1104915394 12:132261800-132261822 GGCAGATGGGGGACAGGCCTGGG + Intronic
1105755145 13:23457139-23457161 GGCATGTGGCAGGGAGGCTGGGG - Intergenic
1106000435 13:25718022-25718044 AGCAGATGGCAGGAAGGGTCTGG + Intronic
1107354633 13:39553844-39553866 GGCAGGTGGCTGGCTGGTTTAGG - Intronic
1107813139 13:44219200-44219222 GGCAGTTGAGAGGGAGGCTTTGG + Intergenic
1108264909 13:48696938-48696960 GCAAGGTGGCAGCCAGGCTTGGG + Intronic
1108473159 13:50787755-50787777 GATAGATGGCAGGGAGTCTTGGG - Intronic
1111985885 13:95066731-95066753 GGCAAGAGGCAGGCAGACTTGGG - Intronic
1112240205 13:97674018-97674040 GGCAGCTGGCAGTCTGGATTTGG - Intergenic
1112510223 13:100002379-100002401 AGCAGATGGCTGGCATTCTTAGG - Intergenic
1113304607 13:109064088-109064110 AGCAGATGGCAGGCCAGATTTGG - Intronic
1113633432 13:111903743-111903765 GGCAGACTGAAGGCAGTCTTAGG + Intergenic
1113850405 13:113414432-113414454 CGCAGAGGGCAGGGAGGCTGGGG - Intergenic
1113869818 13:113552356-113552378 GGCAGACGGGAGGCAGCTTTTGG - Intronic
1113927220 13:113948256-113948278 GGCAGGTGCCAGGCAGACGTTGG - Intergenic
1117263149 14:54057568-54057590 GGCATATGGCAGGCAATCTAAGG + Intergenic
1118034897 14:61856144-61856166 GGAAACTGGCAGGAAGGCTTTGG + Intergenic
1118860691 14:69660659-69660681 AGCAGATGGCAGGTAGGATTTGG - Intronic
1119159839 14:72443688-72443710 ACCTGATGGCTGGCAGGCTTGGG - Intronic
1119193703 14:72701925-72701947 GGCAGATGACAGGCATGGTGGGG - Intronic
1120841572 14:89090047-89090069 GGCAGTGGGCAGGCTGGATTTGG + Intergenic
1121961550 14:98264818-98264840 ACCAGATGGCAGGGAGGCTCTGG - Intergenic
1122148270 14:99707077-99707099 TGCAGAGGGAAGGCAGCCTTTGG - Intronic
1122502622 14:102211405-102211427 TGCAGATGGGAAGCAGGCCTGGG - Intronic
1123107694 14:105850371-105850393 GGCAGGTGGTGGCCAGGCTTGGG - Intergenic
1123405771 15:20018698-20018720 GGCTGAGGACAGGCAGGGTTGGG - Intergenic
1123515101 15:21025346-21025368 GGCTGAGGACAGGCAGGGTTGGG - Intergenic
1123688901 15:22820791-22820813 GGCGGGTGGCAGTCAGACTTGGG - Intronic
1123712891 15:23003074-23003096 GACGGTTGGCAGGCAGGCCTGGG - Exonic
1124237847 15:28005094-28005116 TCCAGGAGGCAGGCAGGCTTGGG + Intronic
1125448827 15:39786610-39786632 AGGAGATGGAGGGCAGGCTTTGG - Intergenic
1125520540 15:40345730-40345752 GGCTGGTAGGAGGCAGGCTTTGG - Intergenic
1125786253 15:42320917-42320939 GGCAGGTGGCAGGCAGGAGCAGG - Intronic
1127389436 15:58493269-58493291 GGCAGACAGTAGGCAGGCTGTGG - Intronic
1127536191 15:59892110-59892132 GGCACATGGCAGGCTTGCCTGGG - Intergenic
1130897623 15:88183366-88183388 GGCACATGGCAGGTACTCTTGGG - Intronic
1131098750 15:89672048-89672070 AGCAGATGGCAGTGAGGCCTTGG + Intronic
1131181229 15:90241419-90241441 GGGAGCTGGCGGGCAGGCTCAGG - Exonic
1131905868 15:97141916-97141938 GGCATATGGCAGGTAAGGTTTGG - Intergenic
1132687683 16:1169126-1169148 GGCCGCTGCCAGGCAGGCTCTGG - Intronic
1132694799 16:1197123-1197145 GGCAGGTGGAAGGCAGGCTCAGG - Intronic
1132814058 16:1817601-1817623 GGAAGATGGGAGCCAGGCATGGG - Intronic
1132882704 16:2169554-2169576 GGCTGACAGCAGGCAGGCCTGGG - Intronic
1134236958 16:12474108-12474130 GGCAGAGGGCAGGTAGCCGTGGG + Intronic
1134349082 16:13419817-13419839 GCCAGGTGGCAGGCTGGATTTGG + Intergenic
1135057583 16:19243398-19243420 AGCAGAGGGGAGGCAGCCTTTGG + Intronic
1135381450 16:21999542-21999564 GGCAGGTGCCAGACAGCCTTAGG - Intronic
1136068435 16:27774154-27774176 AACAGATGCAAGGCAGGCTTTGG - Intronic
1136085203 16:27880071-27880093 AAGAGCTGGCAGGCAGGCTTGGG - Intronic
1136117235 16:28102256-28102278 AGGAGCAGGCAGGCAGGCTTTGG - Intronic
1137237030 16:46625042-46625064 TGCAGAGGGCAGGGAGGCATGGG + Intergenic
1137567479 16:49542596-49542618 GACAGATGCCAGGGAGGCCTGGG + Intronic
1138314691 16:56059858-56059880 TGCAAATGCCAGACAGGCTTAGG + Intergenic
1138521955 16:57576108-57576130 GCCAGATGGCATCCTGGCTTGGG + Exonic
1139361165 16:66401122-66401144 TGCAGATTGGAGGCAGGGTTGGG - Intronic
1139671686 16:68496763-68496785 GGCGGAGGTCAGGAAGGCTTTGG - Intergenic
1140027521 16:71304096-71304118 GCCCGAAGGCAGGCAGGCTGGGG + Intergenic
1140349831 16:74251735-74251757 TGCATATGGCAGACAGGTTTAGG + Intergenic
1140410795 16:74739253-74739275 GGCAGAGGGCATGCAGGGTAGGG + Intronic
1140757162 16:78078070-78078092 GGTGGATGGCAGGCATTCTTGGG + Intergenic
1141606047 16:85154010-85154032 GGCAGATGGCAGGCCACCTGTGG + Intergenic
1141784180 16:86187520-86187542 GGCAGATGGCAGGCCAGGTGTGG + Intergenic
1142426668 16:90005237-90005259 GGCAGGGGGCAGGCTGGCTTGGG + Exonic
1142666267 17:1465597-1465619 GGGAGATTGCAGGTGGGCTTCGG + Exonic
1142685552 17:1575226-1575248 GGCAGGTGGCAGGCAGGGGATGG + Exonic
1143586103 17:7851300-7851322 GCCAGAGGGTAGGCAGGCCTGGG - Intronic
1144341935 17:14317370-14317392 GTCAGGTGGTAGGCAGGCATTGG + Intronic
1145285636 17:21504118-21504140 TGCAGATCCCAGGCTGGCTTTGG + Intergenic
1146793404 17:35765430-35765452 GGCAGAAGACAGGGAGGCTGGGG + Intronic
1147595250 17:41712569-41712591 GGCAGGTGGAAGGCAAGGTTGGG - Intronic
1148084853 17:44987897-44987919 GGCAGAGGACAGGGAGGCCTTGG + Intergenic
1148690983 17:49526799-49526821 ACCAGAGGGCAGACAGGCTTGGG - Intergenic
1148748652 17:49932133-49932155 GGAAGATGGCAGGGATGCTGGGG + Intergenic
1148835538 17:50463919-50463941 GGCCAAGGGCAGCCAGGCTTGGG + Intronic
1148921241 17:51036661-51036683 GCAGGATGGCAGCCAGGCTTGGG - Intronic
1149130163 17:53290906-53290928 GGCAGAGGGCAAGCCAGCTTTGG - Intergenic
1150846718 17:68666083-68666105 GGCAGCTTGCTGGCAGTCTTGGG - Intergenic
1151221707 17:72617744-72617766 GGAAGGAGGCAGGCAGCCTTAGG - Intergenic
1151328092 17:73391164-73391186 ACCAGATGGCCGGCAGGCTGGGG + Intronic
1151486636 17:74405011-74405033 AACAGATGGCAGGCTGGATTTGG + Intergenic
1151706826 17:75773630-75773652 GGGAGATGGGCTGCAGGCTTAGG - Intergenic
1152562611 17:81086081-81086103 GTCCGCTGGCAGGAAGGCTTGGG + Intronic
1152703557 17:81831774-81831796 GGCAGAGTGGAGGCAGACTTTGG - Intronic
1152754349 17:82080936-82080958 GGCAGATGCCAGGCTGGTCTGGG + Intronic
1152876538 17:82789679-82789701 GGCAGATGTCCCTCAGGCTTTGG + Intronic
1153773882 18:8436109-8436131 GGCACGTGGCAGGCAGGCAAAGG - Intergenic
1154148496 18:11886664-11886686 GGCAGACAGCAGGCAGCCTGTGG - Intronic
1154287025 18:13068557-13068579 GGCAGATGGCATGCTGTTTTGGG + Intronic
1155092106 18:22522096-22522118 GGCAGATGGCTGGTGGTCTTGGG + Intergenic
1155610246 18:27658920-27658942 GTCACATGTCAGGCAGTCTTAGG + Intergenic
1156494198 18:37515367-37515389 GGCAGAGGGTAGCCAGGCTGGGG - Intronic
1157401226 18:47390145-47390167 GGAAGATGGCAGGCGGGGTAGGG + Intergenic
1157427524 18:47596469-47596491 AGCAGAAGTCAGGCAGTCTTAGG - Intergenic
1157823545 18:50791668-50791690 GGCCAATGGCAGGCAGCCTGTGG - Intergenic
1158636466 18:59162844-59162866 GGCAGATGACAGACAGTGTTTGG - Intergenic
1159318959 18:66820595-66820617 TGCAGATGTCAGCCAGGATTTGG - Intergenic
1160095836 18:75872081-75872103 CGCAGATATCAGGCAGGCTGCGG - Intergenic
1160246512 18:77164192-77164214 GTCAGTTGGCAGGGAGGCTGAGG + Intergenic
1160518495 18:79491095-79491117 GGGAGAGGGAAGGCAGGCTAGGG + Intronic
1160788920 19:913754-913776 GGCAGGTGGAAGGAAGGCTCGGG - Intergenic
1161136797 19:2624789-2624811 GGCAGAGGGCAGGCGGGCACAGG + Intronic
1161332181 19:3693579-3693601 GGCAGGCGGCAGGGAGGCCTGGG + Intronic
1162573523 19:11485843-11485865 GGCAGCTGGAAGGCAGGCTGGGG + Intronic
1162971573 19:14183960-14183982 GGGAGATCCCAGGCAGGCCTTGG + Intronic
1163835533 19:19571226-19571248 GGCAAGTGGCAGGCTGGCATTGG + Intronic
1164093114 19:21978332-21978354 GGCACATGGCAGGTGGCCTTGGG + Intronic
1164596318 19:29532795-29532817 GGCAGTTGGAAGCCAGGCTATGG + Intronic
1166750791 19:45163174-45163196 AGCAGGTGCGAGGCAGGCTTAGG + Exonic
1167120676 19:47514679-47514701 GGCAGAGGGGACGCAGGCTGAGG - Intronic
1167386745 19:49168131-49168153 GGGAGATGGCAGGCAGGCCGAGG - Intronic
1167701320 19:51048398-51048420 GGCAGAAGGCAGGCAGCTTAAGG - Intergenic
927138228 2:20112830-20112852 AGCAGCGGGCAGACAGGCTTTGG + Intergenic
927308710 2:21603840-21603862 GGCAGATGGGGGGCGGGCTGGGG - Intergenic
928840587 2:35599936-35599958 GGCAGAAGGCAGGCAGCTTTAGG - Intergenic
929463730 2:42126122-42126144 GGCAGCTTGCAGCCAGTCTTTGG - Intergenic
929938497 2:46312612-46312634 TGCAGTTGGAAGGCAGCCTTAGG + Intronic
930768814 2:55111847-55111869 GGCAGGAGGCAGGCAGCATTCGG - Intronic
931720189 2:65061842-65061864 GGCAGAGGCCAAGCAGGCATGGG - Intronic
932740375 2:74286402-74286424 GGCAGCTGGAAAGCAGGCTGGGG - Intronic
933249457 2:80012659-80012681 GTCAAATGGCAGGCTGGATTTGG + Intronic
934753618 2:96810280-96810302 GCCAGATGGGAGGCAGGGTGGGG - Exonic
934767105 2:96885718-96885740 GGGAGATGACAGGCAGGGATTGG + Intronic
936069394 2:109355408-109355430 AACAGTTGGCAGGCAGGATTTGG - Intronic
936285097 2:111175618-111175640 GACAGAGGGCAGACAGGCTTTGG + Intergenic
937451858 2:122008760-122008782 GACACAGGGCAGGCGGGCTTTGG - Intergenic
938262013 2:129903183-129903205 GGCAGGTGATAGGCAGGCTCTGG - Intergenic
938319446 2:130353407-130353429 GGCACATGGCACGTGGGCTTTGG + Intergenic
938712724 2:133989498-133989520 GGGAGATGGCAGGCAAGGTGCGG - Intergenic
938765964 2:134460568-134460590 GGAAGTAGGCAGGCAGGCATGGG + Intronic
939848032 2:147271170-147271192 TGCAGGTGGCTTGCAGGCTTGGG - Intergenic
940103157 2:150065480-150065502 GGAAAATGGAAGGCATGCTTTGG + Intergenic
941697352 2:168567598-168567620 AACAGATGGCAGGCTGGATTTGG + Intronic
942510243 2:176690933-176690955 GCCAGATGGCAGGTATGCTGAGG - Intergenic
944986309 2:205181607-205181629 GGCAGGTGGCAAGCTGGTTTTGG + Intronic
946329297 2:219000668-219000690 GACAGATCCCAGGCAGGTTTAGG - Intergenic
946391147 2:219417806-219417828 CATACATGGCAGGCAGGCTTTGG + Intergenic
947601740 2:231455403-231455425 GGCAGAGGCCGGGGAGGCTTTGG - Exonic
947624565 2:231611678-231611700 GGCTGAGGGCAGGCAGGCTCTGG + Intergenic
948708134 2:239807778-239807800 GGCAGGGGGCAGGCAGGTCTGGG + Intergenic
948931200 2:241133499-241133521 GGAAGAGGGCATGCAGTCTTAGG - Intronic
948974965 2:241458378-241458400 GGCATCTGGAAGGCAGGCCTTGG - Intronic
1168848650 20:961735-961757 AGCAGCTGGCAGGCAGGCCTAGG - Intronic
1168850943 20:976618-976640 GGCAGATGGAAGGCATGATATGG - Intronic
1168876147 20:1173649-1173671 TGCAGCTGGGAGGCAGGCATCGG + Intronic
1168953726 20:1819799-1819821 GGCATCTGGGAGTCAGGCTTGGG + Intergenic
1169076202 20:2761053-2761075 GGGCGTGGGCAGGCAGGCTTTGG - Intergenic
1169374214 20:5053352-5053374 GTCAGATGACAGCCAGGCATGGG + Intergenic
1170159134 20:13295034-13295056 GGCAGCTGGCAAGAGGGCTTTGG - Intronic
1170907428 20:20528642-20528664 AGCAGATGGATGGCAGGCATGGG - Intronic
1171191770 20:23164091-23164113 AGCTGATGACAGGCAGGCTGTGG + Intergenic
1171795362 20:29561929-29561951 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1171853090 20:30322336-30322358 CCCAGATGGCAGGCAAGCCTGGG + Intergenic
1172036967 20:32018026-32018048 GGCAGCGGGCAGACAGGCTCAGG - Exonic
1172182073 20:33009712-33009734 GGCAGAGGGCAGGAAGGCGGCGG - Intronic
1172234005 20:33357415-33357437 GGCAAAGGCCAGGGAGGCTTTGG + Intergenic
1173211264 20:41034410-41034432 GGCAGGTGGCAGGGAGGGTGGGG - Intronic
1174768851 20:53279470-53279492 AGCAGATGGCAGGCTGGATCAGG + Intronic
1175533517 20:59690845-59690867 GGCCTTTGGCAGGGAGGCTTTGG - Intronic
1175941566 20:62539745-62539767 TGCAGATAGTAGGGAGGCTTGGG - Intergenic
1175972228 20:62692312-62692334 GGCAGCTGGCACCCAGGCATAGG - Intergenic
1176011714 20:62900384-62900406 AGCAGAAGGCTGGCTGGCTTGGG + Intronic
1177195746 21:17901692-17901714 GGCAGAAGGGAGGCAGGACTAGG - Intronic
1179129882 21:38625662-38625684 GTCAGAAGTCAGGCTGGCTTGGG - Intronic
1179654525 21:42837187-42837209 GGGTGATGGCAGGGAGGCCTGGG + Intergenic
1179824234 21:43955058-43955080 GGCAGCTGGCACCCAGCCTTTGG - Intronic
1180087156 21:45512903-45512925 GGTAGATGGGAGGGAGGCTCAGG + Exonic
1181171555 22:21012858-21012880 GACAGATGGCATGAAGGGTTGGG - Intronic
1181624539 22:24114306-24114328 GGGAGATCACAGGCAGGCTGGGG + Intronic
1182552170 22:31106431-31106453 CGCAGGTGGCAGGCAGGGTGAGG - Intronic
1182710583 22:32320514-32320536 TGCAGAGACCAGGCAGGCTTGGG + Intergenic
1182862083 22:33568886-33568908 GATGGATGGCAGGCAGGCATAGG + Intronic
1183048605 22:35241920-35241942 GGCGGATGGGAGGCAGGACTAGG - Intergenic
1183331864 22:37226517-37226539 GGCAGATGACAAGTAGGCTGCGG + Intronic
1184311517 22:43647832-43647854 GCCGGATGGCAGGCAGCCATTGG + Intronic
1184694787 22:46133273-46133295 GGCAGATGGCTGGCATGCTGGGG + Intergenic
1184719311 22:46300640-46300662 GCTAGGTGCCAGGCAGGCTTGGG - Intronic
1184787773 22:46680143-46680165 GTCAGGGGGCATGCAGGCTTTGG + Intergenic
1185339523 22:50285224-50285246 GGCCGGTGACAGGCAGGCTCAGG - Intronic
1185339549 22:50285307-50285329 GGCCGGTGACAGGCAGGCTCAGG - Intronic
1185339562 22:50285348-50285370 GGCCGGTGACAGGCAGGCTCAGG - Intronic
1185339575 22:50285389-50285411 GGCCGGTGACAGGCAGGCTCAGG - Intronic
1185339602 22:50285473-50285495 GGCCGGTGACAGGCAGGCTCAGG - Intronic
1185339615 22:50285514-50285536 GGCCGGTGACAGGCAGGCTCAGG - Intronic
1185339639 22:50285595-50285617 GGCCGGTGACAGGCAGGCTCAGG - Intronic
1185339663 22:50285676-50285698 GGCCGGTGACAGGCAGGCTCAGG - Intronic
1185339676 22:50285717-50285739 GGCCGGTGACAGGCAGGCTCAGG - Intronic
1185339688 22:50285758-50285780 GGCTGGTGACAGGCAGGCTCAGG - Intronic
949563944 3:5228160-5228182 GGCAGAGAGAAGGCAGGATTTGG + Intergenic
949887719 3:8709674-8709696 AGCAGATGGGAGGAAGGCATGGG + Intronic
953186356 3:40641809-40641831 GGCAGTTGGAAGTCAGGCCTGGG + Intergenic
953681331 3:45040580-45040602 AGCAGATGGCATGTGGGCTTTGG - Intergenic
954263599 3:49457240-49457262 GTCAGATGTCAGGAAGGCTTGGG + Intergenic
954392561 3:50275240-50275262 GACCGATGGGAGGCAGGCGTGGG + Intronic
954430992 3:50470761-50470783 GGCAGAGAGCAGGCCGGGTTGGG + Intronic
955052412 3:55425398-55425420 GTCAGCTGGCAGGTTGGCTTGGG + Intergenic
955111477 3:55954768-55954790 GGCAAAAGGAAGGCATGCTTTGG - Intronic
955486277 3:59438050-59438072 AGCAGGTGGCAGGCTGGATTTGG - Intergenic
955633797 3:61003785-61003807 GGCAGATGCCTGGAAGGCATGGG - Intronic
956048763 3:65224760-65224782 GGCAAATGCCTGGCAAGCTTGGG - Intergenic
956713826 3:72061136-72061158 GCCAGCTGCCAGGCAGGCTCAGG - Intergenic
959426232 3:106192458-106192480 TGCTGATGGCAGACAGGCTAGGG - Intergenic
960156100 3:114298451-114298473 GCCAGATTGGAGGCAGGGTTAGG - Intronic
961319906 3:126065243-126065265 GGCAGAGGGCAGGCATGGTATGG - Intronic
961328586 3:126126015-126126037 GGGTGATGGCAGGCAGGCACAGG + Intronic
961329902 3:126132279-126132301 GGGAAACGGCTGGCAGGCTTTGG - Intronic
961750148 3:129089739-129089761 TGCAGAGGGCAGGGAGGCATGGG + Exonic
962198485 3:133382458-133382480 GGCAGATGGGAGACAGGCCCAGG - Intronic
963758290 3:149258969-149258991 GGCAGATGGCTCTCAGGCTCTGG - Intergenic
963946019 3:151146271-151146293 TGCAGATGGCAGGAAGGCAGAGG - Intronic
964438296 3:156675694-156675716 GGCGGCGGGCGGGCAGGCTTTGG + Intronic
964884370 3:161464525-161464547 GGCAGATGGCTCTCAGGCTATGG + Intergenic
965127345 3:164648283-164648305 GGCTGATGGCAGCCTGGGTTGGG + Intergenic
966888553 3:184389968-184389990 GGCAGTTGGCTGGCATGCCTGGG + Intronic
966944715 3:184769769-184769791 GACAGATGGCCAGCAGTCTTGGG + Intergenic
967246166 3:187489120-187489142 GGCAGATGGCATAAAGTCTTTGG + Intergenic
967329618 3:188277337-188277359 GGCACCTGGCAGCCAGGCTATGG - Intronic
967843999 3:194030254-194030276 GGCAGCTGGTGGGCAGGCTCAGG - Intergenic
967895491 3:194392747-194392769 GGCTCACGGCAGGCAGCCTTGGG - Intergenic
968905032 4:3447050-3447072 AGCAGATGGGAGCCAGGCTCAGG + Intronic
969090541 4:4690776-4690798 GGCAGCTGGTGGGCAGGCTTTGG + Intergenic
969588007 4:8105665-8105687 CGCAGAAGGCAGGCAGGCACGGG + Intronic
970111331 4:12640824-12640846 TGCAGAGGACAGGCAGTCTTTGG - Intergenic
970423850 4:15928938-15928960 GGCAGAGTGCAGGGAGGATTCGG - Intergenic
970439154 4:16065191-16065213 GGCATATGGCATGCAGGCTCTGG - Intronic
972656883 4:41072348-41072370 GGCAGATGGCGGCTAGGCTTTGG + Intronic
972717054 4:41656996-41657018 GCCAGATGCCAGGTAGGCTTTGG + Intronic
974350922 4:60744961-60744983 ACCAGATTGCAGGCAGGCCTTGG - Intergenic
975041652 4:69751846-69751868 AACAGATGGAAGGCAGGATTGGG - Intronic
975675249 4:76821410-76821432 GGCAGATGGGAGAAAGCCTTAGG + Intergenic
977566598 4:98587002-98587024 GGCAGTTGGGAGGCAGGGTGGGG + Intronic
980018169 4:127677023-127677045 GCAAGATGGCAGGGAGGCTGGGG + Intronic
980235539 4:130100157-130100179 GGCACATGTCATGCAGGCTTGGG + Intergenic
985585347 5:729462-729484 GGAATATGGCAGGCAGGCTGGGG + Intronic
985598859 5:813789-813811 GGAATATGGCAGGCAGGCTGGGG + Intronic
986581318 5:9269253-9269275 GCCAGATGGCAGGCAGGAGATGG + Intronic
986600106 5:9464653-9464675 GGCAGATGGCATCCAAGCCTGGG - Intronic
988455093 5:31380534-31380556 AACAGATGGCGGGCTGGCTTTGG - Intergenic
990780545 5:59356990-59357012 GAGAGATGGCAGGCTGGCTGAGG + Intronic
990857076 5:60280253-60280275 GGCAGAAGGCAGACTAGCTTGGG - Intronic
992155007 5:73946221-73946243 GGTAGAAAGAAGGCAGGCTTGGG + Intergenic
992158085 5:73974229-73974251 AGCCAAAGGCAGGCAGGCTTAGG + Intergenic
992298665 5:75354044-75354066 GGCAGATGGTAGACAGGGATGGG + Intronic
993532549 5:89042155-89042177 GGCAGATGGCAGGCCAGCTTGGG + Intergenic
993833543 5:92788808-92788830 GGCACATGGCAGCCATGCCTGGG - Intergenic
998383392 5:141741841-141741863 AGAAGATGGCAGGCAGGAATGGG + Intergenic
998474595 5:142409538-142409560 GGGAGGTGGCAGGCAGCCGTGGG + Intergenic
999238020 5:150111419-150111441 TGCAGAGGGCAGGCAGGGTCTGG - Intronic
999244670 5:150147485-150147507 GGCAGGGGACAGGCAGGCCTTGG + Intronic
1000730439 5:164828385-164828407 GGCTGATGGCAGCCTGGGTTGGG - Intergenic
1001002800 5:168023432-168023454 GTCAGCTGGCAGGCAGCCGTCGG - Intronic
1001559816 5:172661699-172661721 CGCAGATGGCATGCTGGCTGAGG - Intronic
1001728778 5:173931559-173931581 TGCAGATGGCATGTGGGCTTTGG + Intronic
1002064563 5:176645615-176645637 GGCAGAAGGGAGGGAGGCTATGG - Intronic
1002079752 5:176730371-176730393 GGCACATGGCAGCCAGGGATGGG + Intergenic
1002160732 5:177312571-177312593 GGCAGATGGCAGGCAGGCTTGGG - Intronic
1002199780 5:177521221-177521243 GGCAGCTAGCAGGCAGACCTTGG - Intronic
1002260792 5:177992770-177992792 GGCAGATGGCCGGCAGGGGCTGG + Exonic
1004205828 6:13591498-13591520 GGCAGATGCCAGGCAGGGTCTGG - Intronic
1004311971 6:14553871-14553893 GGCAGCAGGCAGGCAGGATTTGG - Intergenic
1006813002 6:36832753-36832775 GGCAGAGAGGAGTCAGGCTTGGG - Intronic
1006969586 6:38027757-38027779 GGCAGATGGGAGGTATGGTTGGG + Intronic
1007177202 6:39905104-39905126 GGCAGAGGGGAGGCAGGCAGGGG + Exonic
1007266548 6:40600599-40600621 GGCAGATGGCTGTCACCCTTGGG + Intergenic
1007628119 6:43257945-43257967 GGCAGACGGCAGCCATGTTTGGG + Exonic
1009935378 6:70228020-70228042 GGCAGATGGGAGACAGGGATAGG + Intronic
1011559438 6:88599800-88599822 GGGAGGTGGGAGGCAGGCTGGGG + Intergenic
1013455737 6:110327953-110327975 TACAGGTGGCAGGCAGGATTGGG - Intronic
1016311967 6:142743978-142744000 GGCAGGGGGCAGGGAGGTTTGGG - Intergenic
1017887453 6:158610792-158610814 GACAGGTAGCCGGCAGGCTTGGG + Intronic
1017984788 6:159434500-159434522 GGCTGTTGACAGGCAGGCTGTGG - Intergenic
1018576397 6:165264385-165264407 TGCAGATGGCATCCAGGGTTAGG - Intergenic
1018676015 6:166222962-166222984 GGCAGATGGGAGTCAGGGTCAGG + Intergenic
1019365460 7:630386-630408 GGCAGGTGGCAGGCAGGCAGCGG + Intronic
1019557820 7:1641356-1641378 GGCAGGGGGCAGGCAGGGTGAGG - Intergenic
1021922090 7:25495611-25495633 AGCAGTTGGCAGGCAGGCCACGG + Intergenic
1022707969 7:32823799-32823821 AGCAGTTGGCAGCCAGGCCTGGG - Intergenic
1022885781 7:34642281-34642303 TGCAGATAGCAGGTAGGCTGGGG + Intergenic
1022902233 7:34822237-34822259 GGCAGCTGAGAGGCAGGGTTCGG + Intronic
1022914990 7:34939542-34939564 AGCAGTTGGCAGCCAGGCCTGGG + Intronic
1023828592 7:44026054-44026076 GGCAGAAGCCAGCAAGGCTTGGG + Intergenic
1025731949 7:64115066-64115088 GGCAGGTGGCAGGCTGGGGTGGG + Intronic
1026361534 7:69605365-69605387 GGCAGATGTCAGGCAGGAAAGGG - Intronic
1026473388 7:70713200-70713222 CACAGATGGCAGGCCGGCATTGG - Intronic
1026804567 7:73421921-73421943 GGCACATGGCAGGCAGGAGAAGG + Intergenic
1027911790 7:84260814-84260836 AGCAGAAGGCAGATAGGCTTAGG + Intronic
1028596102 7:92547387-92547409 GGCAGGAGGCAGACAGGCTCTGG + Intergenic
1028958469 7:96721465-96721487 GGAATATGGCGGGCAGGGTTGGG + Intergenic
1029524188 7:101085332-101085354 GGCAGGCAGCTGGCAGGCTTGGG - Intergenic
1029738887 7:102480334-102480356 GGCAGAAGCCAGCAAGGCTTGGG + Intergenic
1029756888 7:102579497-102579519 GGCAGAAGCCAGCAAGGCTTGGG + Intronic
1029774827 7:102678557-102678579 GGCAGAAGCCAGCAAGGCTTGGG + Intergenic
1032191238 7:129767151-129767173 GGCATGTGGCAGGGAGGCTGTGG - Intergenic
1033430161 7:141281836-141281858 GCCAAGTGGCAGGCAGGCCTGGG + Intronic
1034956633 7:155339170-155339192 GTCTGGTGGCAGCCAGGCTTGGG - Intergenic
1034982275 7:155486825-155486847 GGCAGATGGCAGCGAGGCCCTGG - Intronic
1035033832 7:155882407-155882429 GGCAGGAGACAGCCAGGCTTGGG + Intergenic
1035515985 8:232569-232591 GGCAGCTGGGCGACAGGCTTCGG - Exonic
1035620234 8:1031065-1031087 CGCAGACGCCAGGCAGGCTCTGG - Intergenic
1036669382 8:10771037-10771059 GGCTGATGACAGACAGGCTGTGG - Intronic
1037163290 8:15797641-15797663 GGCAAATGGCAGGGAAGTTTAGG + Intergenic
1037808169 8:22069825-22069847 TGCTGATGGCAGGGAGGCTGGGG - Intronic
1038966015 8:32573388-32573410 AACAGATGGTAGGCAGGATTTGG + Intronic
1039964191 8:42271758-42271780 GGCAGAAGGCGGGCAGGCCCGGG + Intronic
1040646484 8:49402901-49402923 AACAGATGGCAGGCTGGATTTGG - Intergenic
1040811209 8:51455709-51455731 GGCAGAAGGGAAGGAGGCTTTGG + Intronic
1042727601 8:71894239-71894261 GGCAGGTGGCTATCAGGCTTTGG + Intronic
1042875210 8:73435220-73435242 GGCAAATGGCAGGCACTGTTAGG - Intronic
1044807380 8:96021897-96021919 GGCTGTTGTCAGCCAGGCTTGGG - Intergenic
1044963475 8:97553888-97553910 GGCAGAGGGCAGGTATGCTTTGG + Intergenic
1045903051 8:107308162-107308184 ATCACATGACAGGCAGGCTTGGG - Intronic
1047679477 8:127239654-127239676 GGAAGTTGGCAGTCAGGCTTCGG - Intergenic
1048311031 8:133322754-133322776 GGCAGATGGCAGGCTGACTTGGG + Intergenic
1049007197 8:139863148-139863170 GGCAGAAGCCAGGAAGGCTACGG + Intronic
1049282593 8:141757983-141758005 GGCAGATGAGAGCCAGGCCTGGG - Intergenic
1049595415 8:143481150-143481172 GCCAGATTGCAGGCAGCCCTGGG + Intronic
1049600882 8:143507013-143507035 GGCAGATGGGAAGCAGGCAGTGG - Intronic
1049621327 8:143599582-143599604 GGCAGAGGGCAGACTGGCTGGGG - Exonic
1049683242 8:143929110-143929132 GGTAGATGGCAGACAGGCTGCGG + Exonic
1049696273 8:143985703-143985725 GGCAGGTGAGAGGCAGGGTTGGG - Exonic
1051472105 9:17455738-17455760 GGGGAATGGCAGGCAGGTTTGGG + Intronic
1051472111 9:17455758-17455780 GGGGAATGGCAGGCAGGTTTGGG + Intronic
1051472117 9:17455778-17455800 GGGGAATGGCAGGCAGGTTTGGG + Intronic
1051505423 9:17822016-17822038 AGCAAAAGGCAGGCAGGCTGGGG - Intergenic
1051721201 9:20039366-20039388 GGCAGCTGGCAGCAAGGCTGAGG + Intergenic
1052861824 9:33442253-33442275 GGCAGAGGAGAGGCAGGCTGGGG + Intronic
1053107569 9:35424957-35424979 GTCAGGTGGCAATCAGGCTTAGG - Intergenic
1053790888 9:41685635-41685657 CCCAGATGGCAGGCAAGCCTGGG + Intergenic
1054154266 9:61629137-61629159 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1054179235 9:61897329-61897351 CCCAGATGGCAGGCAAGCCTGGG + Intergenic
1054474051 9:65560257-65560279 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1054658303 9:67683492-67683514 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1055460183 9:76512082-76512104 GGCAGGCGGAAGGCAGGCTCAGG + Intergenic
1056698035 9:88877555-88877577 GACAGATGGGATGCAGGGTTAGG - Intergenic
1059202508 9:112431155-112431177 AGCAGATGGAGGGCAAGCTTAGG + Intronic
1059522326 9:114955214-114955236 AGCAGGTGGTAGGCAGGATTTGG + Intergenic
1060176835 9:121503400-121503422 GGCCTCTGGCAGGCAGGGTTTGG + Intergenic
1060934143 9:127506051-127506073 GGCAGGAGGGAGGCAGGCTGGGG + Exonic
1061127534 9:128686313-128686335 GGGAGGTGGCAGGGAGGGTTGGG + Intronic
1061481760 9:130900892-130900914 GACAGGTGGCAGGAAGGGTTAGG + Intergenic
1062004612 9:134232991-134233013 GGCAGTTGGCAGACTAGCTTCGG + Intergenic
1062040708 9:134403083-134403105 GGGAGATGGCATGGGGGCTTGGG - Intronic
1062116785 9:134813885-134813907 GGCAGACAGCAGGCAGGATTTGG + Intronic
1062372676 9:136248112-136248134 GGCAGATTTCACGCAGGCTTTGG - Intergenic
1062492443 9:136812852-136812874 GGCAGAAGCCAGGAAGGCTTTGG - Intronic
1187463601 X:19509026-19509048 GGAAAATGGCAGGCAGGCCTTGG - Intronic
1189097761 X:38158125-38158147 GGCAGTGGCCAGGCTGGCTTTGG + Intronic
1189728840 X:43997472-43997494 GGCAGCAGGCATGCAGGCCTAGG + Intergenic
1190150550 X:47943944-47943966 GGCAGATGGCAAGCCGGGCTGGG + Intronic
1190277746 X:48910118-48910140 GGGTGAGGGCAGGCAGGCTGAGG - Intronic
1192342884 X:70278552-70278574 GGCAGCTGGCAGCCAGGATTGGG - Exonic
1192587378 X:72329649-72329671 GGCAGCTGACAGGCAGGGTTTGG - Exonic
1193417433 X:81241311-81241333 GGCAGAAGGCAGACAGTCTCCGG + Intronic
1197046664 X:122005551-122005573 GGAGGATGGGAGGAAGGCTTGGG + Intergenic
1197705521 X:129631892-129631914 GGCATGAGGCAGGCAGGGTTAGG + Intergenic
1198537003 X:137596427-137596449 GGCAGTTGGCAGACAGGAATCGG - Intergenic
1199383783 X:147200696-147200718 GGCAGGCGGCAGCCTGGCTTGGG + Intergenic
1200137320 X:153881455-153881477 GGCAGATGGCAGGCAAATGTCGG + Intronic
1201237310 Y:11923605-11923627 GGAAGAAGGCATGCAAGCTTGGG - Intergenic
1201975038 Y:19839809-19839831 GCAAGATGGCAGGAAGGCTGGGG - Intergenic