ID: 1002163082

View in Genome Browser
Species Human (GRCh38)
Location 5:177328315-177328337
Sequence CCTCTGGGTTTCCCCAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002163082_1002163091 5 Left 1002163082 5:177328315-177328337 CCTCACCTGGGGAAACCCAGAGG No data
Right 1002163091 5:177328343-177328365 GAGGCCCTCGTCGGCAGGCTCGG No data
1002163082_1002163089 -4 Left 1002163082 5:177328315-177328337 CCTCACCTGGGGAAACCCAGAGG No data
Right 1002163089 5:177328334-177328356 GAGGAACTGGAGGCCCTCGTCGG No data
1002163082_1002163092 6 Left 1002163082 5:177328315-177328337 CCTCACCTGGGGAAACCCAGAGG No data
Right 1002163092 5:177328344-177328366 AGGCCCTCGTCGGCAGGCTCGGG No data
1002163082_1002163090 0 Left 1002163082 5:177328315-177328337 CCTCACCTGGGGAAACCCAGAGG No data
Right 1002163090 5:177328338-177328360 AACTGGAGGCCCTCGTCGGCAGG No data
1002163082_1002163095 26 Left 1002163082 5:177328315-177328337 CCTCACCTGGGGAAACCCAGAGG No data
Right 1002163095 5:177328364-177328386 GGGCATCTGACCAGCCGCAGTGG No data
1002163082_1002163096 27 Left 1002163082 5:177328315-177328337 CCTCACCTGGGGAAACCCAGAGG No data
Right 1002163096 5:177328365-177328387 GGCATCTGACCAGCCGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002163082 Original CRISPR CCTCTGGGTTTCCCCAGGTG AGG (reversed) Intergenic
No off target data available for this crispr