ID: 1002163087

View in Genome Browser
Species Human (GRCh38)
Location 5:177328330-177328352
Sequence CGAGGGCCTCCAGTTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002163087_1002163096 12 Left 1002163087 5:177328330-177328352 CCCAGAGGAACTGGAGGCCCTCG No data
Right 1002163096 5:177328365-177328387 GGCATCTGACCAGCCGCAGTGGG No data
1002163087_1002163095 11 Left 1002163087 5:177328330-177328352 CCCAGAGGAACTGGAGGCCCTCG No data
Right 1002163095 5:177328364-177328386 GGGCATCTGACCAGCCGCAGTGG No data
1002163087_1002163097 19 Left 1002163087 5:177328330-177328352 CCCAGAGGAACTGGAGGCCCTCG No data
Right 1002163097 5:177328372-177328394 GACCAGCCGCAGTGGGCACACGG No data
1002163087_1002163092 -9 Left 1002163087 5:177328330-177328352 CCCAGAGGAACTGGAGGCCCTCG No data
Right 1002163092 5:177328344-177328366 AGGCCCTCGTCGGCAGGCTCGGG No data
1002163087_1002163091 -10 Left 1002163087 5:177328330-177328352 CCCAGAGGAACTGGAGGCCCTCG No data
Right 1002163091 5:177328343-177328365 GAGGCCCTCGTCGGCAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002163087 Original CRISPR CGAGGGCCTCCAGTTCCTCT GGG (reversed) Intergenic
No off target data available for this crispr