ID: 1002163088

View in Genome Browser
Species Human (GRCh38)
Location 5:177328331-177328353
Sequence ACGAGGGCCTCCAGTTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002163088_1002163097 18 Left 1002163088 5:177328331-177328353 CCAGAGGAACTGGAGGCCCTCGT No data
Right 1002163097 5:177328372-177328394 GACCAGCCGCAGTGGGCACACGG No data
1002163088_1002163096 11 Left 1002163088 5:177328331-177328353 CCAGAGGAACTGGAGGCCCTCGT No data
Right 1002163096 5:177328365-177328387 GGCATCTGACCAGCCGCAGTGGG No data
1002163088_1002163095 10 Left 1002163088 5:177328331-177328353 CCAGAGGAACTGGAGGCCCTCGT No data
Right 1002163095 5:177328364-177328386 GGGCATCTGACCAGCCGCAGTGG No data
1002163088_1002163092 -10 Left 1002163088 5:177328331-177328353 CCAGAGGAACTGGAGGCCCTCGT No data
Right 1002163092 5:177328344-177328366 AGGCCCTCGTCGGCAGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002163088 Original CRISPR ACGAGGGCCTCCAGTTCCTC TGG (reversed) Intergenic
No off target data available for this crispr