ID: 1002163090

View in Genome Browser
Species Human (GRCh38)
Location 5:177328338-177328360
Sequence AACTGGAGGCCCTCGTCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002163075_1002163090 28 Left 1002163075 5:177328287-177328309 CCCGGCCACACCAGCTGCTGTTA No data
Right 1002163090 5:177328338-177328360 AACTGGAGGCCCTCGTCGGCAGG No data
1002163076_1002163090 27 Left 1002163076 5:177328288-177328310 CCGGCCACACCAGCTGCTGTTAG No data
Right 1002163090 5:177328338-177328360 AACTGGAGGCCCTCGTCGGCAGG No data
1002163078_1002163090 18 Left 1002163078 5:177328297-177328319 CCAGCTGCTGTTAGATCTCCTCA No data
Right 1002163090 5:177328338-177328360 AACTGGAGGCCCTCGTCGGCAGG No data
1002163077_1002163090 23 Left 1002163077 5:177328292-177328314 CCACACCAGCTGCTGTTAGATCT No data
Right 1002163090 5:177328338-177328360 AACTGGAGGCCCTCGTCGGCAGG No data
1002163082_1002163090 0 Left 1002163082 5:177328315-177328337 CCTCACCTGGGGAAACCCAGAGG No data
Right 1002163090 5:177328338-177328360 AACTGGAGGCCCTCGTCGGCAGG No data
1002163084_1002163090 -5 Left 1002163084 5:177328320-177328342 CCTGGGGAAACCCAGAGGAACTG No data
Right 1002163090 5:177328338-177328360 AACTGGAGGCCCTCGTCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002163090 Original CRISPR AACTGGAGGCCCTCGTCGGC AGG Intergenic
No off target data available for this crispr