ID: 1002163092

View in Genome Browser
Species Human (GRCh38)
Location 5:177328344-177328366
Sequence AGGCCCTCGTCGGCAGGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002163087_1002163092 -9 Left 1002163087 5:177328330-177328352 CCCAGAGGAACTGGAGGCCCTCG No data
Right 1002163092 5:177328344-177328366 AGGCCCTCGTCGGCAGGCTCGGG No data
1002163084_1002163092 1 Left 1002163084 5:177328320-177328342 CCTGGGGAAACCCAGAGGAACTG No data
Right 1002163092 5:177328344-177328366 AGGCCCTCGTCGGCAGGCTCGGG No data
1002163088_1002163092 -10 Left 1002163088 5:177328331-177328353 CCAGAGGAACTGGAGGCCCTCGT No data
Right 1002163092 5:177328344-177328366 AGGCCCTCGTCGGCAGGCTCGGG No data
1002163082_1002163092 6 Left 1002163082 5:177328315-177328337 CCTCACCTGGGGAAACCCAGAGG No data
Right 1002163092 5:177328344-177328366 AGGCCCTCGTCGGCAGGCTCGGG No data
1002163078_1002163092 24 Left 1002163078 5:177328297-177328319 CCAGCTGCTGTTAGATCTCCTCA No data
Right 1002163092 5:177328344-177328366 AGGCCCTCGTCGGCAGGCTCGGG No data
1002163077_1002163092 29 Left 1002163077 5:177328292-177328314 CCACACCAGCTGCTGTTAGATCT No data
Right 1002163092 5:177328344-177328366 AGGCCCTCGTCGGCAGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002163092 Original CRISPR AGGCCCTCGTCGGCAGGCTC GGG Intergenic
No off target data available for this crispr