ID: 1002163094

View in Genome Browser
Species Human (GRCh38)
Location 5:177328348-177328370
Sequence GATGCCCGAGCCTGCCGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002163094_1002163103 24 Left 1002163094 5:177328348-177328370 CCTCGTCGGCAGGCTCGGGCATC No data
Right 1002163103 5:177328395-177328417 CCGCCCTAGCTGGAAGGAGCCGG No data
1002163094_1002163101 18 Left 1002163094 5:177328348-177328370 CCTCGTCGGCAGGCTCGGGCATC No data
Right 1002163101 5:177328389-177328411 ACACGGCCGCCCTAGCTGGAAGG No data
1002163094_1002163104 25 Left 1002163094 5:177328348-177328370 CCTCGTCGGCAGGCTCGGGCATC No data
Right 1002163104 5:177328396-177328418 CGCCCTAGCTGGAAGGAGCCGGG No data
1002163094_1002163096 -6 Left 1002163094 5:177328348-177328370 CCTCGTCGGCAGGCTCGGGCATC No data
Right 1002163096 5:177328365-177328387 GGCATCTGACCAGCCGCAGTGGG No data
1002163094_1002163097 1 Left 1002163094 5:177328348-177328370 CCTCGTCGGCAGGCTCGGGCATC No data
Right 1002163097 5:177328372-177328394 GACCAGCCGCAGTGGGCACACGG No data
1002163094_1002163100 14 Left 1002163094 5:177328348-177328370 CCTCGTCGGCAGGCTCGGGCATC No data
Right 1002163100 5:177328385-177328407 GGGCACACGGCCGCCCTAGCTGG No data
1002163094_1002163095 -7 Left 1002163094 5:177328348-177328370 CCTCGTCGGCAGGCTCGGGCATC No data
Right 1002163095 5:177328364-177328386 GGGCATCTGACCAGCCGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002163094 Original CRISPR GATGCCCGAGCCTGCCGACG AGG (reversed) Intergenic
No off target data available for this crispr