ID: 1002163097

View in Genome Browser
Species Human (GRCh38)
Location 5:177328372-177328394
Sequence GACCAGCCGCAGTGGGCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002163084_1002163097 29 Left 1002163084 5:177328320-177328342 CCTGGGGAAACCCAGAGGAACTG No data
Right 1002163097 5:177328372-177328394 GACCAGCCGCAGTGGGCACACGG No data
1002163093_1002163097 2 Left 1002163093 5:177328347-177328369 CCCTCGTCGGCAGGCTCGGGCAT No data
Right 1002163097 5:177328372-177328394 GACCAGCCGCAGTGGGCACACGG No data
1002163094_1002163097 1 Left 1002163094 5:177328348-177328370 CCTCGTCGGCAGGCTCGGGCATC No data
Right 1002163097 5:177328372-177328394 GACCAGCCGCAGTGGGCACACGG No data
1002163087_1002163097 19 Left 1002163087 5:177328330-177328352 CCCAGAGGAACTGGAGGCCCTCG No data
Right 1002163097 5:177328372-177328394 GACCAGCCGCAGTGGGCACACGG No data
1002163088_1002163097 18 Left 1002163088 5:177328331-177328353 CCAGAGGAACTGGAGGCCCTCGT No data
Right 1002163097 5:177328372-177328394 GACCAGCCGCAGTGGGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002163097 Original CRISPR GACCAGCCGCAGTGGGCACA CGG Intergenic
No off target data available for this crispr